ID: 1010701683

View in Genome Browser
Species Human (GRCh38)
Location 6:79056575-79056597
Sequence AATTGTGACAAGGGGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 117}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010701676_1010701683 12 Left 1010701676 6:79056540-79056562 CCAGGAGATATTTGGCAATGTCT 0: 10
1: 89
2: 479
3: 865
4: 1469
Right 1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 117
1010701675_1010701683 13 Left 1010701675 6:79056539-79056561 CCCAGGAGATATTTGGCAATGTC 0: 8
1: 82
2: 402
3: 803
4: 1287
Right 1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010701683 Original CRISPR AATTGTGACAAGGGGGTAGT GGG Intronic
901145070 1:7059259-7059281 AATTTTGTCAAGGAGGTGGTGGG + Intronic
905777280 1:40676922-40676944 AATTGTCCTAAGGGGGTAGAGGG - Intergenic
908879769 1:68717982-68718004 AATTGAGACAAGGGGTTCATTGG - Intergenic
908956604 1:69637474-69637496 AGTTGTGATAAGTGGGTTGTGGG - Intronic
917080761 1:171254826-171254848 AATTCTGACAATGGGTTGGTAGG - Intronic
920868629 1:209774460-209774482 CATTGTGGGATGGGGGTAGTTGG + Intronic
921345395 1:214178672-214178694 AATTGTGGCAGGGGGGAAATGGG + Intergenic
922669751 1:227500298-227500320 AATTGTTTCCAGGGGGTTGTTGG - Intergenic
922900677 1:229134171-229134193 AATTGGAACCAGGAGGTAGTGGG + Intergenic
924910923 1:248512304-248512326 AATCGTGAGAAGGGGGGAGTTGG + Intergenic
924913178 1:248535736-248535758 AATCGTGAGAAGGGGGGAGTTGG - Intergenic
1066604098 10:37142350-37142372 AAGTGTGATATGGGAGTAGTTGG + Intronic
1069003832 10:63295799-63295821 AAATGTGACAAGGGGCTCATTGG - Intronic
1069814211 10:71183423-71183445 AAATGTGAGAAGGAGGTAGCAGG + Intergenic
1069827048 10:71260792-71260814 AATTGTGATGAGTGGGCAGTGGG + Intronic
1074109038 10:110409563-110409585 AACTGTGGCAGGGGGGTAGAGGG - Intergenic
1074201583 10:111241091-111241113 TAATGTGACAAAGGGGTTGTTGG - Intergenic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1078877831 11:15415779-15415801 AATTGTGGCAAGAGGGCAGGGGG - Intergenic
1081162748 11:39771133-39771155 ATTTGTGACATGGTGGTATTTGG - Intergenic
1085320954 11:75573620-75573642 GATTGTGACCTGGGGGTTGTTGG + Intergenic
1085599519 11:77842576-77842598 AAGTATGGCCAGGGGGTAGTCGG + Exonic
1091109395 11:132951664-132951686 ACTTGTGACAATGGGGAATTAGG - Intronic
1091404331 12:199611-199633 AATTGTAACAAGTTGGTAATAGG - Intronic
1094720176 12:33055118-33055140 AATTTTTCCATGGGGGTAGTAGG + Intergenic
1095403390 12:41840603-41840625 AAAAGTGCCAAGGGAGTAGTTGG + Intergenic
1095540537 12:43304300-43304322 GATTGTGATAAAGAGGTAGTAGG - Intergenic
1101952675 12:109188549-109188571 AATTGGGAAAAGGAGGAAGTGGG - Intronic
1103774684 12:123358418-123358440 AATTGTGACAAAGGGATAATGGG - Intronic
1108600698 13:51991862-51991884 AATTATGAAAAGGGGGAAATAGG - Intronic
1108987898 13:56616887-56616909 AATTTTGATAAGGAGGTAATGGG - Intergenic
1110980427 13:81890168-81890190 AATTGTGACAAGCGGGGTGTGGG - Intergenic
1111788443 13:92821305-92821327 AATTGTGAAAAGGAAGTAGTAGG - Intronic
1116390357 14:44384008-44384030 AATTGTGAAAAAGGGTTTGTGGG - Intergenic
1116390903 14:44388231-44388253 AATTGTGAAAAAGGGTTTGTGGG - Intergenic
1117107135 14:52409450-52409472 AATTGGGAGACGGGGGTAGAGGG - Intergenic
1120502654 14:85316098-85316120 TCTCATGACAAGGGGGTAGTTGG + Intergenic
1120589812 14:86362447-86362469 AATAATGACAAGGAGGTAGATGG + Intergenic
1122406867 14:101505912-101505934 AATGGTGAAAAGGGGGCAGGAGG - Intergenic
1123765035 15:23469921-23469943 AATTGTGGCAAGGATGTTGTTGG + Intergenic
1127528520 15:59818121-59818143 AATCCTTACAAGGGGGTAGTGGG + Intergenic
1128530691 15:68444606-68444628 AATTCTGACAAGTGTTTAGTTGG - Intergenic
1131215568 15:90532730-90532752 AATTTTGAGAAGGGAGTACTAGG + Intronic
1134240567 16:12503047-12503069 CATTCTGACAAGGGGCCAGTAGG + Intronic
1134756262 16:16670233-16670255 AAGTGTGAGAAGGGGTTAGCCGG - Intergenic
1134989808 16:18688931-18688953 AAGTGTGAGAAGGGGTTAGCCGG + Intergenic
1137914516 16:52414455-52414477 AAATATGATGAGGGGGTAGTGGG - Intergenic
1140380124 16:74479359-74479381 TATAGTGACTAGGGGGTAGGAGG - Intronic
1140906165 16:79411094-79411116 AAATGGGACAAGGGAGGAGTTGG - Intergenic
1142721396 17:1778359-1778381 AACTGTGACAAGGGAGTGGCCGG - Intergenic
1143515739 17:7418388-7418410 ACTTGTGCCAAGGGGGGCGTCGG - Exonic
1146496716 17:33329230-33329252 AACTGTGAAATGGGGGTATTAGG + Intronic
1146920669 17:36708246-36708268 AATTGTGAAAAGTGGGTAACTGG - Intergenic
1149501412 17:57155658-57155680 AATTGTAATCATGGGGTAGTAGG + Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1155013529 18:21807607-21807629 AATTGTTACAAGTGGGTGGGTGG + Intronic
1164544614 19:29149589-29149611 ACTTGTGAGAAGGTGGTAGAAGG + Intergenic
1165638950 19:37367894-37367916 AATTGTAAGAAAGGGGTAGAAGG + Intronic
1167125918 19:47548620-47548642 AATTGTGTCATGGGAGGAGTTGG - Intronic
1167637391 19:50662686-50662708 GAATGTGACAAGGGGGCAGTGGG + Intronic
925425911 2:3748474-3748496 ATTCCTGACAAGGGGGAAGTGGG + Intronic
927315495 2:21676385-21676407 AATAGTGAGAAGGGGGTTGTGGG + Intergenic
929211005 2:39357109-39357131 AATTTGGACAAGGAGGCAGTAGG - Intronic
929626759 2:43416710-43416732 AATTATGAAAAGAGGGCAGTAGG + Intronic
934782432 2:96979960-96979982 AATTCTGACATGTGGCTAGTAGG - Intronic
935365209 2:102282093-102282115 AATTGTGACAAGGTGTTTCTAGG - Intergenic
938625762 2:133107211-133107233 GATGATGACAAGGAGGTAGTGGG - Intronic
939771458 2:146324959-146324981 AATTCTGACATGTGGGCAGTAGG - Intergenic
941623269 2:167802699-167802721 AATTGTAACAAGGGCTTAATAGG - Intergenic
943964412 2:194314276-194314298 AATTGTGAAATGGTGGTTGTCGG - Intergenic
1168903314 20:1384592-1384614 GATTGAGACAAGTGGGTAGTTGG - Intronic
1169630030 20:7621193-7621215 AATAGTGAGAAGGAGTTAGTAGG - Intergenic
1173398370 20:42702056-42702078 AAGTGTGACAAGTGGGAAGTGGG - Intronic
1173658214 20:44715524-44715546 AATTCTGCCAAGGGGGTCCTTGG - Intronic
1175365147 20:58448463-58448485 AACTGTGACTGGGGGGTAGATGG + Exonic
1183519134 22:38286407-38286429 AATTTTGAAAAGAGGGTAATCGG + Intergenic
963404516 3:144845013-144845035 AATTGGTACCAGGAGGTAGTGGG - Intergenic
964939698 3:162142457-162142479 AATTGTGATAAGTGGGTAAATGG + Intergenic
964979864 3:162665668-162665690 AATTGTGAAAAGGGACTTGTGGG + Intergenic
966668687 3:182502146-182502168 AAAGGGGACAAGGGGGGAGTGGG + Intergenic
967683024 3:192387294-192387316 AGATGTGACAAGGGGCTATTCGG + Intronic
967743760 3:193031830-193031852 AAGTGTGACAGGGAGGTAATCGG + Intergenic
970914519 4:21317230-21317252 AAATATGAAAAGGGGATAGTTGG - Intronic
972882053 4:43436967-43436989 AATTGCCACAATTGGGTAGTTGG + Intergenic
975736321 4:77384813-77384835 CATTGAGACAAGGGGCTAGAAGG - Intronic
975759526 4:77605212-77605234 AATTCTTAGAAGGGGGCAGTAGG - Intronic
975851360 4:78576071-78576093 AATTGTGACAATGTGGTGTTGGG - Intronic
983157731 4:164371813-164371835 AATTGTGAAAATGTTGTAGTGGG - Intronic
984704080 4:182835157-182835179 AATAGAGACAAGGTGGTGGTGGG - Intergenic
987370288 5:17186761-17186783 AAATGTGAAAAGGGGGAAGCCGG - Intronic
988113516 5:26853630-26853652 AGTTGTGTCAATGGAGTAGTGGG - Intergenic
989530094 5:42497990-42498012 AATTTTGCCAAGGGGGAGGTTGG + Intronic
989814882 5:45723773-45723795 AATTGTGACATGGTTGCAGTGGG + Intergenic
992263609 5:74994904-74994926 GATCCTGACAAGTGGGTAGTTGG + Intergenic
993118025 5:83741006-83741028 AAATGTGACTCGGGGGTAGGGGG + Intergenic
1001404650 5:171467363-171467385 AGTTGTGACAACTGGGGAGTTGG - Intergenic
1001866533 5:175110884-175110906 AACTGTGACAGAGGGGAAGTTGG + Intergenic
1007393530 6:41564098-41564120 GACTGTGACTCGGGGGTAGTTGG + Intronic
1010701683 6:79056575-79056597 AATTGTGACAAGGGGGTAGTGGG + Intronic
1011169550 6:84490400-84490422 AATTGGTACCAGGAGGTAGTGGG - Intergenic
1015151435 6:130043499-130043521 AAATGAGAGATGGGGGTAGTTGG - Intronic
1017018026 6:150117002-150117024 AGTGGTGAGAAGGGGGTGGTCGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017863217 6:158418505-158418527 AATTGAGCCAAGTGGCTAGTTGG + Intronic
1018690155 6:166338163-166338185 AATTGTCAGCAGGGGTTAGTAGG + Intronic
1022861231 7:34369185-34369207 AACTGTGAGAAGGGGTGAGTGGG - Intergenic
1027513318 7:79110289-79110311 AGTTGTGAGAAGAGGGTGGTGGG + Intronic
1032148291 7:129404018-129404040 AATAGTGAGAAGGGGGCAGGTGG + Intronic
1040812606 8:51472691-51472713 AATTGTGTAAAGTGGGTGGTTGG - Intronic
1042061283 8:64820875-64820897 AGTAGTGACAAAGGGGTACTTGG + Intergenic
1045463600 8:102448413-102448435 AGTTGAGAAAAGGGGGCAGTGGG - Intergenic
1047286193 8:123489147-123489169 ATCTGTGAGATGGGGGTAGTGGG + Intergenic
1047624607 8:126643730-126643752 AAGTGTGTCATGGAGGTAGTGGG + Intergenic
1048154911 8:131937318-131937340 AACTGTGAGAAGTAGGTAGTAGG + Intronic
1048458023 8:134595729-134595751 AATTGGAAGAAGGAGGTAGTGGG + Intronic
1050734330 9:8746148-8746170 AATTGTGACAAGGTGGGAACGGG + Intronic
1051783768 9:20719882-20719904 AATTGTGGCAAGGGCATTGTGGG + Intronic
1052049191 9:23825555-23825577 AAATGTGGCCAGGGGGGAGTAGG - Intronic
1054963592 9:70997157-70997179 AAATGTGACAAGGGGGTAGGAGG - Intronic
1061264614 9:129497763-129497785 AAGAATGACAAGGGGGTAGCGGG + Intergenic
1062132531 9:134907252-134907274 GATTGTGGCAGGGGCGTAGTAGG + Intronic
1186443245 X:9604121-9604143 AATTGGGAGAAGGGTGGAGTGGG - Intronic
1189123552 X:38421664-38421686 ACTTGTGAGAATGTGGTAGTGGG + Intronic
1189234109 X:39474578-39474600 AACTGGGACAAGGTGGTAGGGGG + Intergenic
1191001062 X:55660082-55660104 AATAGGGCCAAGGGTGTAGTGGG + Intergenic
1191667775 X:63721016-63721038 AATTGAGACAAGGGGTAAGTGGG - Intronic
1194185238 X:90766911-90766933 AATTGGTACTAGGAGGTAGTGGG - Intergenic
1195278732 X:103310045-103310067 AATTTTGAAAGGTGGGTAGTCGG - Intronic
1196922846 X:120602508-120602530 AATTAAGACAAGGTGTTAGTTGG + Intronic
1200531861 Y:4348998-4349020 AATTGGTACTAGGAGGTAGTGGG - Intergenic