ID: 1010703129

View in Genome Browser
Species Human (GRCh38)
Location 6:79077106-79077128
Sequence CGCGCGAGAGTCGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010703129_1010703138 7 Left 1010703129 6:79077106-79077128 CCGCCGCCGCCGACTCTCGCGCG 0: 1
1: 0
2: 4
3: 38
4: 289
Right 1010703138 6:79077136-79077158 GCCCGCACGGACGCGCGCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 78
1010703129_1010703133 -6 Left 1010703129 6:79077106-79077128 CCGCCGCCGCCGACTCTCGCGCG 0: 1
1: 0
2: 4
3: 38
4: 289
Right 1010703133 6:79077123-79077145 CGCGCGCCCCCGCGCCCGCACGG No data
1010703129_1010703141 22 Left 1010703129 6:79077106-79077128 CCGCCGCCGCCGACTCTCGCGCG 0: 1
1: 0
2: 4
3: 38
4: 289
Right 1010703141 6:79077151-79077173 CGCGCCGGCCCCTCCTCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010703129 Original CRISPR CGCGCGAGAGTCGGCGGCGG CGG (reversed) Intronic
900116993 1:1033183-1033205 CGCGCGGGAGTCGGGGGCGCCGG + Intronic
900189984 1:1349227-1349249 CGCGCGGGAGCCGGGGGCGGCGG - Intronic
900349719 1:2228634-2228656 CGGCCGTGAGCCGGCGGCGGGGG + Intergenic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
903078111 1:20787346-20787368 CGCGCGGGAGGCGGGGCCGGCGG - Intergenic
903750210 1:25616797-25616819 AGCCCGAGCGGCGGCGGCGGCGG + Intergenic
904039296 1:27575177-27575199 AGCCCCAGAGGCGGCGGCGGCGG - Intronic
906480948 1:46198468-46198490 CGCGGCAGCGGCGGCGGCGGCGG - Intronic
909170023 1:72282907-72282929 AGGGCGAGCGGCGGCGGCGGCGG + Intergenic
912305239 1:108560254-108560276 GCCGCGAGAGGCGGCGGCAGCGG + Exonic
915255772 1:154627590-154627612 TGCGCGAGTGTGGGCGGCAGAGG - Intronic
915393153 1:155562419-155562441 GGCGGGAGCGGCGGCGGCGGCGG + Exonic
915953488 1:160205393-160205415 GGCGGAAGAGGCGGCGGCGGCGG + Exonic
916651667 1:166839612-166839634 CGCGCGGGCGGGGGCGGCGGCGG + Intronic
918275765 1:182952872-182952894 CACGGGAGAGGCGGCGGCGGCGG - Exonic
919712283 1:200739614-200739636 CCCGGGAGCGGCGGCGGCGGCGG + Exonic
921603982 1:217135521-217135543 CGCGCGCGCGGCGGCGGCGGCGG + Intronic
924415164 1:243850287-243850309 GGAGCGGGAGGCGGCGGCGGCGG + Intronic
1062874125 10:931585-931607 CGGGCGCGAGCTGGCGGCGGCGG + Exonic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712825 10:28533495-28533517 CGCGCAGGCGGCGGCGGCGGCGG - Exonic
1068690155 10:59906294-59906316 GGCGGGGGAGGCGGCGGCGGTGG - Exonic
1068762991 10:60733290-60733312 CGCGGGAGAGGAGGAGGCGGAGG + Intronic
1070025259 10:72626098-72626120 CACGTGAGAGTGGGCGGAGGGGG - Exonic
1070577021 10:77687083-77687105 AGCGGGAGAGTGGGCGGCTGAGG - Intergenic
1071579506 10:86756614-86756636 CTGGCAAGAGTCGGCGGCGGTGG + Intergenic
1072003565 10:91220804-91220826 CGGGCGAGGAGCGGCGGCGGTGG + Intronic
1072562231 10:96586896-96586918 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1072710791 10:97714469-97714491 CCCGCGCGGGGCGGCGGCGGGGG - Exonic
1074815416 10:117138242-117138264 CGCGCGCGGGTCAGCGGCGACGG + Intronic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1077105990 11:842894-842916 CGAGCGGGAGGCGGCGGCGCAGG + Intronic
1077201504 11:1309682-1309704 CGCGCGAGAGCCGGAAGGGGCGG - Intergenic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1077506040 11:2930328-2930350 GGGGCGAGGGTCGGCGGGGGCGG + Intergenic
1078091677 11:8268201-8268223 CGCCCGGGCTTCGGCGGCGGCGG - Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1081672855 11:44951073-44951095 CGCCCGAGAGAAGGCGCCGGGGG + Intronic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1086887743 11:92224599-92224621 CGCGCGGGAGGGGGCGGCGGAGG - Intergenic
1087014666 11:93543375-93543397 CGCGCCAGAGTCGCCCGCGCGGG - Exonic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091550295 12:1531001-1531023 CGCGCGAGGTTCGGCAGCCGGGG - Intronic
1092810383 12:12266896-12266918 CGCGGTAGAGAGGGCGGCGGCGG - Intronic
1095432045 12:42144757-42144779 CGGGCGCAAGGCGGCGGCGGCGG - Exonic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096784406 12:54009030-54009052 CGAGCGGGCGGCGGCGGCGGCGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1097164877 12:57078669-57078691 GGCTCGGGAGTCGGGGGCGGTGG - Exonic
1098161156 12:67649041-67649063 CGGCCGGGAGGCGGCGGCGGCGG + Exonic
1099989761 12:89709306-89709328 GGCGCGAGCTTCGGCGGCGGTGG - Intergenic
1101144824 12:101830942-101830964 CGGGCGAGAGGCGGCTGCGGCGG + Intergenic
1103433066 12:120904243-120904265 CGCTCGGGCGGCGGCGGCGGCGG + Exonic
1103749867 12:123151153-123151175 CGGGGGAGCGGCGGCGGCGGCGG + Intergenic
1103764668 12:123271660-123271682 CGCGAGGGCGGCGGCGGCGGCGG + Exonic
1103779528 12:123389455-123389477 CGCGGTGGAGGCGGCGGCGGCGG + Exonic
1104940559 12:132392580-132392602 CGGGGGAGAGTGGGTGGCGGAGG - Intergenic
1105217513 13:18297715-18297737 CGCGGTGGAGGCGGCGGCGGCGG + Intergenic
1106602653 13:31200535-31200557 AGCGCGAGTGGCGGCGGCGGCGG + Intronic
1108541988 13:51453351-51453373 CGCGCGCGGGGCGGCCGCGGCGG + Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113201064 13:107867592-107867614 CGCGCGGGGGCGGGCGGCGGCGG + Intergenic
1113541773 13:111115150-111115172 CGTGCGCGGGGCGGCGGCGGCGG - Intronic
1113655606 13:112066658-112066680 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1117680690 14:58200110-58200132 CGCTCGGGCGTCGGCGACGGCGG - Intronic
1117803105 14:59464974-59464996 AGCGCGGGAGGCGGGGGCGGCGG - Exonic
1117875779 14:60249215-60249237 CGCGCTAGAGGCGGCGGCGGCGG + Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118836822 14:69484086-69484108 TGCGCGCTAGGCGGCGGCGGCGG + Intergenic
1119357489 14:74019222-74019244 TGTGCGAGTGTCGGCGGCGCCGG - Intronic
1119410342 14:74426249-74426271 CGAGAGGGAGGCGGCGGCGGCGG - Intergenic
1121751717 14:96363249-96363271 AGCGCGAGAGGAGGCGGCAGGGG + Exonic
1122918554 14:104870062-104870084 CGGGAGAGAGTCGGTGGCTGGGG + Intronic
1122975330 14:105168535-105168557 AGCGGCAGAGGCGGCGGCGGCGG + Exonic
1123739934 15:23226415-23226437 TGCGCGCGAGTCGGAGGCCGCGG - Intergenic
1124291158 15:28455383-28455405 TGCGCGCGAGTCGGAGGCCGCGG - Intergenic
1125200753 15:37099064-37099086 CGCGCGAGCCACGGCGGCAGCGG + Intronic
1126113287 15:45187758-45187780 CGCGGGGGGGGCGGCGGCGGAGG - Intronic
1127103320 15:55588502-55588524 GGAGCGCGAGGCGGCGGCGGTGG - Intronic
1127144110 15:56007288-56007310 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144118 15:56007306-56007328 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144126 15:56007324-56007346 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144134 15:56007342-56007364 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144142 15:56007360-56007382 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127165767 15:56243791-56243813 GGAGCGAGCGGCGGCGGCGGCGG - Intergenic
1127763574 15:62164450-62164472 CGCGCAGGAGGCGGCAGCGGCGG + Exonic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1128972247 15:72117988-72118010 ACTGCGAGAGGCGGCGGCGGAGG - Exonic
1129348282 15:74938167-74938189 CGCGCGGCCGGCGGCGGCGGGGG + Exonic
1129675976 15:77632637-77632659 AGCGGCAGAGGCGGCGGCGGCGG - Intronic
1130002562 15:80059921-80059943 CGCCCGAGAGCCGGAAGCGGAGG + Intronic
1130362964 15:83207692-83207714 AGCGCGCGCGGCGGCGGCGGCGG - Exonic
1130370802 15:83284336-83284358 CGGCCGGGAGGCGGCGGCGGGGG - Intronic
1132516919 16:370290-370312 CGGGTGAGAGTCGGGGGCCGGGG - Intronic
1132985658 16:2765951-2765973 CGCGGGTTACTCGGCGGCGGAGG + Exonic
1134143604 16:11742758-11742780 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1134419322 16:14071335-14071357 GGCGGGAGCGGCGGCGGCGGCGG + Intronic
1136365677 16:29808040-29808062 CGCGTGGGAGGAGGCGGCGGCGG + Intronic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1137655256 16:50153549-50153571 TGCGCCTGAGGCGGCGGCGGCGG + Intronic
1138023199 16:53503021-53503043 CGCTCGCGACTCGGCGACGGCGG - Intronic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1139402942 16:66696654-66696676 CGGGCGAGAGGCGGCGGCGGCGG - Exonic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1141079203 16:81035956-81035978 CGGGCCCGAGGCGGCGGCGGCGG - Exonic
1141797928 16:86287095-86287117 AGCGCGGGAGTGAGCGGCGGCGG - Intergenic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1143494976 17:7307658-7307680 GGCGGTAGAGGCGGCGGCGGCGG + Intronic
1143750072 17:9021516-9021538 AGCGCGAGTGGCGGCGGCGGCGG + Intergenic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1145214708 17:21042855-21042877 CGCGCGGGGGGCGGCGGCGAGGG + Exonic
1145925654 17:28644951-28644973 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1147150394 17:38510674-38510696 CGCCCGAGACCCGGCGGCGCCGG + Exonic
1147285911 17:39402285-39402307 GGCGGGGGAGGCGGCGGCGGCGG - Intronic
1147313134 17:39606690-39606712 CGCACGAGACTCGGGGGTGGAGG - Intronic
1147844995 17:43398918-43398940 CGCGGGACAATCAGCGGCGGCGG - Intergenic
1148060099 17:44830241-44830263 GGAGCGGGAGGCGGCGGCGGCGG - Intronic
1148284086 17:46372762-46372784 TGCGCGAGGGCGGGCGGCGGGGG + Intergenic
1148306307 17:46590683-46590705 TGCGCGAGGGCGGGCGGCGGGGG + Exonic
1148936235 17:51166410-51166432 CACCCGGGAGCCGGCGGCGGAGG - Intronic
1150250557 17:63702091-63702113 CGAGTGAGTGTCGGGGGCGGCGG - Intergenic
1150624821 17:66835086-66835108 GGCGCGAGCTGCGGCGGCGGCGG + Intergenic
1152362540 17:79839349-79839371 GGGGCGAGCGGCGGCGGCGGCGG - Exonic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1155392742 18:25352367-25352389 GGCGCGAGGGGCGGCGGCGCAGG - Intergenic
1155654535 18:28177849-28177871 CGCGCGCGAGTGAGCGGCGCAGG - Intergenic
1156099674 18:33578489-33578511 CGCGCGGGCGGTGGCGGCGGCGG - Intergenic
1156698819 18:39799340-39799362 CGGGCGGGAGGGGGCGGCGGCGG + Intergenic
1157473775 18:48008576-48008598 CGCGGGCGGGCCGGCGGCGGAGG - Intergenic
1158893557 18:61894176-61894198 CGCTACAGAGGCGGCGGCGGCGG + Intronic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1160025390 18:75211668-75211690 CGCTCAGGAGGCGGCGGCGGCGG - Intronic
1160500715 18:79400130-79400152 CGCGCGCGAGGGGGCGGGGGCGG + Intronic
1160592367 18:79951616-79951638 CGCGCGCGGGTCAGCGGCGCGGG - Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160829259 19:1095324-1095346 GGTGCGAGCGGCGGCGGCGGCGG - Exonic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1161779231 19:6279988-6280010 CGGGCCCTAGTCGGCGGCGGGGG - Intergenic
1162374479 19:10296559-10296581 CGCGGCCGAGTCGCCGGCGGAGG + Exonic
1162395830 19:10417719-10417741 CGGACGAGAGGCGGCGGCGAGGG - Intronic
1162731419 19:12721213-12721235 CGGGCCACAGGCGGCGGCGGCGG + Intronic
1162742689 19:12782652-12782674 CGCGCGTGCGTGGGCGGTGGCGG + Intronic
1162744620 19:12791565-12791587 CGCGCCAGAGAGGGCGACGGGGG + Exonic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1165349522 19:35268522-35268544 CGCGCGCGCGGCGGCGGCGGCGG - Intergenic
1166219132 19:41353902-41353924 GGCGCGAAGGGCGGCGGCGGCGG + Exonic
1166317983 19:41999209-41999231 CGCCCGGGCGTCGGCGCCGGCGG + Exonic
1166546997 19:43639801-43639823 GGAGCGAGCGGCGGCGGCGGCGG - Exonic
1166759027 19:45213088-45213110 CGCGCTAGAGACGGAGGCCGGGG + Exonic
1166852851 19:45768697-45768719 CGAGGGTGAGGCGGCGGCGGCGG - Exonic
1166880655 19:45927972-45927994 CCGGCGAGAGGCTGCGGCGGTGG + Intergenic
1166891341 19:45995577-45995599 CGGGGGAGAGTGGGCTGCGGTGG + Intronic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167383418 19:49150947-49150969 CGACCGAGAGTCGGGGGCGAGGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1168293858 19:55369602-55369624 AGCGGGAGAGCTGGCGGCGGGGG + Intronic
1202693091 1_KI270712v1_random:105037-105059 CGGCGGAGAGGCGGCGGCGGCGG + Intergenic
925730752 2:6918011-6918033 CGCGGGCGAGCTGGCGGCGGGGG + Intronic
929778340 2:44942231-44942253 GGCGCGGGAGGCGGCAGCGGCGG + Exonic
931348699 2:61470432-61470454 CGCCCGAGAGGCGGCCGCCGCGG - Intronic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
935112220 2:100104487-100104509 GGCCCGAGCCTCGGCGGCGGCGG - Exonic
935692614 2:105744880-105744902 CGCGGCAGCGGCGGCGGCGGCGG - Exonic
936122757 2:109760661-109760683 GGCCCGAGCTTCGGCGGCGGCGG + Intergenic
936221936 2:110610812-110610834 GGCCCGAGCTTCGGCGGCGGCGG - Intergenic
938338999 2:130523055-130523077 GGCGCGGGAGTTGGCGCCGGGGG + Intronic
938350839 2:130597695-130597717 GGCGCGGGAGTTGGCGCCGGGGG - Intronic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
941686841 2:168456304-168456326 CGCGGAGGAGGCGGCGGCGGCGG + Exonic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
943639557 2:190343686-190343708 CGCGGGAAAGCCGGGGGCGGCGG + Exonic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944675934 2:202034202-202034224 CGAGCGAGCGGCGGCGGCAGGGG + Intergenic
945189033 2:207166945-207166967 CGCGGGAGGGAGGGCGGCGGCGG - Intronic
946019855 2:216633599-216633621 GGCGCGAGTGGCGGCGGCGGCGG + Exonic
947353636 2:229271308-229271330 CGAGCGCGCGGCGGCGGCGGGGG + Intergenic
948206637 2:236166208-236166230 CGGGCAAGAACCGGCGGCGGCGG - Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
1169065563 20:2692798-2692820 CCCGGGAGCGGCGGCGGCGGCGG + Intergenic
1169849543 20:10034867-10034889 GGCGCGAGGGGCGGAGGCGGAGG + Intronic
1172277229 20:33686287-33686309 CGGGTGACAGGCGGCGGCGGCGG + Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1175715501 20:61252396-61252418 CGGGGGAGCGGCGGCGGCGGCGG + Intergenic
1175847372 20:62065827-62065849 GGCCCGAGCGGCGGCGGCGGCGG - Intergenic
1175873682 20:62219901-62219923 GGCGGGCGAGGCGGCGGCGGCGG - Exonic
1176194568 20:63831292-63831314 CGCGCGCGCGCGGGCGGCGGGGG - Intergenic
1176548556 21:8212128-8212150 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1176556450 21:8256336-8256358 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1176567487 21:8395163-8395185 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1176575389 21:8439378-8439400 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1176952685 21:15065054-15065076 CGCGGCGGACTCGGCGGCGGAGG - Intergenic
1179607612 21:42527395-42527417 CACACGAGAGTCAGGGGCGGGGG - Intronic
1179674890 21:42974689-42974711 GGCGAGAGCGGCGGCGGCGGCGG - Intronic
1180101815 21:45590970-45590992 TGCGGGAGAGGCGGAGGCGGGGG + Intergenic
1181007531 22:20021104-20021126 CACCCGGAAGTCGGCGGCGGTGG + Exonic
1181085142 22:20436424-20436446 GGCCCGGGAGTCCGCGGCGGCGG + Intronic
1182604028 22:31489674-31489696 CGAGTAAGGGTCGGCGGCGGTGG - Intronic
1183524975 22:38317408-38317430 AGCGCGCGAGCCGGCGGCGGGGG - Exonic
1184523808 22:45009883-45009905 CGCGCGGGAGGAGGCGGCGGCGG - Intronic
1185349588 22:50327463-50327485 CGAGCGCGAGTCCGCGGTGGTGG - Intergenic
1185398411 22:50604002-50604024 CGCTCGAGCGGCGGCCGCGGGGG + Exonic
1203253440 22_KI270733v1_random:128433-128455 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1203261494 22_KI270733v1_random:173511-173533 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
949987810 3:9553639-9553661 CGCGCGCGAGGCTGCGGCCGCGG + Intronic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
952382587 3:32816849-32816871 CGGGCGCGAGCCGGCGGCGTTGG + Intergenic
959256823 3:104025763-104025785 AGAGCGAGACTCGGTGGCGGGGG + Intergenic
959530735 3:107431543-107431565 CGCCCGAGCCCCGGCGGCGGCGG - Intergenic
961827630 3:129606993-129607015 AGAGCGAGCGACGGCGGCGGCGG - Intergenic
963038507 3:141051889-141051911 CGCCCCTGAGTGGGCGGCGGCGG + Exonic
965590652 3:170357729-170357751 CGGGCGAGCGGCGACGGCGGCGG + Intronic
968914098 4:3489620-3489642 CGGGCGAGGGTGGGCGGTGGTGG + Intronic
968965542 4:3767478-3767500 CGGCCGAGAGGCGGCGGCGCCGG + Exonic
970195096 4:13544526-13544548 CGCGCAGCAGTGGGCGGCGGCGG - Exonic
970620345 4:17811203-17811225 CGGGCGAGAGGCGGCGGCCGGGG - Intronic
971406028 4:26321247-26321269 CGCGTGAGGGCGGGCGGCGGCGG + Intronic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
972671444 4:41216399-41216421 CGCGGTGGAGTCCGCGGCGGCGG + Intronic
975778980 4:77819664-77819686 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
975986213 4:80203078-80203100 CGCTAGAGGGTCCGCGGCGGCGG - Exonic
976178021 4:82373855-82373877 CGCGCGAGAGTGGGAGGCGAAGG - Exonic
978126989 4:105146714-105146736 CGCTCGCGAGGAGGCGGCGGCGG - Exonic
983941620 4:173538842-173538864 CGCGCGGGGGGAGGCGGCGGAGG + Intergenic
985549177 5:524517-524539 CGCTCGCGAGTGCGCGGCGGGGG - Intergenic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
992067460 5:73120715-73120737 CGCGCCTGCGCCGGCGGCGGCGG + Intronic
993726948 5:91380223-91380245 CGCGCGGGCGGCAGCGGCGGCGG - Intronic
994367110 5:98928815-98928837 CGCGCGCGCGACGGCGGCGGCGG - Exonic
994367135 5:98928940-98928962 CGCGCGGGAGGCGGAGGCGACGG - Exonic
997585219 5:135039789-135039811 CGGGCGACGGGCGGCGGCGGCGG - Intronic
998166670 5:139848281-139848303 CGCGCGCGCGGCCGCGGCGGCGG + Exonic
999300237 5:150486226-150486248 CGGGCGGGAGGAGGCGGCGGCGG + Intronic
1001529906 5:172454492-172454514 CGAGCGAAGGGCGGCGGCGGTGG - Exonic
1002029343 5:176416458-176416480 CGCGGGGGAGCCGGCGTCGGCGG + Exonic
1002058068 5:176610052-176610074 CGCTCGGGCGGCGGCGGCGGCGG - Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1002926965 6:1610394-1610416 CGAGCGAGGGTGGGGGGCGGCGG + Exonic
1004663349 6:17729038-17729060 CGCGCAGGAGCCGGCGGTGGTGG - Intergenic
1005327889 6:24720277-24720299 GGCGGAAGAGGCGGCGGCGGCGG + Exonic
1005554180 6:26956622-26956644 CGCGCGGGAGCCCGCGGCTGGGG + Intergenic
1006089671 6:31620898-31620920 CGCGGGAGAGGTGGTGGCGGTGG + Intronic
1006337377 6:33427805-33427827 CGCGAGAGAGACGGGGGAGGGGG - Intronic
1006385425 6:33728187-33728209 CTCCACAGAGTCGGCGGCGGTGG - Exonic
1010703129 6:79077106-79077128 CGCGCGAGAGTCGGCGGCGGCGG - Intronic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013207514 6:107958184-107958206 CTCGCGAGAGCTGGCGACGGCGG - Exonic
1014913375 6:127118838-127118860 CGGGCGAGCGGCGGCGGCGGCGG - Exonic
1016923493 6:149317954-149317976 AGTGGGAGAGGCGGCGGCGGCGG + Intronic
1017103151 6:150865910-150865932 CGCGCTAGCAGCGGCGGCGGCGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019536130 7:1530786-1530808 CGAGCGCCAGGCGGCGGCGGCGG + Exonic
1019562566 7:1665875-1665897 CGAGCGCGGGGCGGCGGCGGCGG - Intergenic
1019626538 7:2018762-2018784 CGGGCGGGAGTGGGTGGCGGAGG - Intronic
1019989585 7:4682394-4682416 CGCGGGGAAGGCGGCGGCGGCGG - Exonic
1020727339 7:11832144-11832166 CCCGCCAGAGGCGGCGGCGGCGG - Exonic
1021827915 7:24573270-24573292 CGCCCAAGCGGCGGCGGCGGCGG + Intronic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1024043861 7:45574559-45574581 CGCGGCGGAGGCGGCGGCGGAGG + Exonic
1026360601 7:69598624-69598646 GGCGAGAGAAGCGGCGGCGGCGG + Intergenic
1026765168 7:73155463-73155485 CGCGAGCGAAGCGGCGGCGGGGG - Intergenic
1027041641 7:74965218-74965240 CGCGAGCGAAGCGGCGGCGGGGG - Intronic
1027082001 7:75237151-75237173 CGCGAGCGAAGCGGCGGCGGGGG + Intergenic
1028987740 7:97021356-97021378 CGCCCGAGTGTCCTCGGCGGCGG + Intronic
1029390584 7:100271696-100271718 CGCGAGCGAAGCGGCGGCGGGGG + Intronic
1029456215 7:100673839-100673861 CGCGGCGGAGGCGGCGGCGGCGG - Exonic
1030820724 7:114087614-114087636 CGCACGTGCGGCGGCGGCGGCGG + Intronic
1032194101 7:129779939-129779961 CCCGCGAGAGGGGGCGGCGCCGG + Intergenic
1032215280 7:129952690-129952712 CGTGCGGGGGGCGGCGGCGGCGG - Exonic
1032306231 7:130734190-130734212 CGCGCGGGCGGCGGCGGCAGCGG - Intergenic
1034342776 7:150368864-150368886 GGAGCGAGAGTGGGCCGCGGAGG + Exonic
1034441152 7:151086680-151086702 CGCGGCGGAGGCGGCGGCGGCGG - Intronic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1037901903 8:22693386-22693408 GGCGGCAGAGGCGGCGGCGGCGG - Intergenic
1037902298 8:22695092-22695114 GGCGGGAGAGGCGGCGGGGGTGG - Intergenic
1038575641 8:28701612-28701634 CGCGCAGGCGGCGGCGGCGGCGG + Exonic
1038828554 8:31033190-31033212 AGTGCGAGCGGCGGCGGCGGGGG - Exonic
1039542299 8:38382229-38382251 GGCGGGAGAGGCGGCGGCGGCGG - Exonic
1039595453 8:38787130-38787152 CGCGCGCGCGGGGGCGGCGGCGG - Intronic
1039843397 8:41309198-41309220 CGCGCGCGGGGAGGCGGCGGAGG - Exonic
1041690003 8:60679109-60679131 CCCGGGAGGGGCGGCGGCGGCGG + Intronic
1043019638 8:74984572-74984594 CGAACGAGGCTCGGCGGCGGAGG - Exonic
1043388252 8:79768308-79768330 CGCGCTGGCGGCGGCGGCGGCGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1044115252 8:88327522-88327544 CGGGCTGGAGGCGGCGGCGGCGG - Intronic
1046659965 8:116938477-116938499 CGTGCAGGAGGCGGCGGCGGCGG + Exonic
1049145648 8:141000207-141000229 CGCGGCAGAGTCGGGGGCTGGGG + Intronic
1049471751 8:142777826-142777848 CGCGGGCGAGTGGGCGGAGGCGG - Exonic
1049746964 8:144267094-144267116 CGGGCGGGAGGCGGCGGGGGCGG - Exonic
1049776825 8:144409777-144409799 CGCGGGAGTGTTGGCGGCGGGGG - Intronic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1051170564 9:14315355-14315377 GGAGCAAGAGGCGGCGGCGGCGG - Intronic
1052941497 9:34134746-34134768 CGCGGCAGCGGCGGCGGCGGCGG - Intergenic
1053114610 9:35490122-35490144 CGCGCCGGCGGCGGCGGCGGCGG - Intronic
1053188204 9:36036912-36036934 CGCGCGAGCGGCGGCGGTAGCGG + Exonic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1055945719 9:81689516-81689538 GGCGCGAGAGGCGCGGGCGGCGG - Intergenic
1056154050 9:83817559-83817581 CGCGGGAGAGGCGGCGGCGGGGG - Exonic
1056356447 9:85805534-85805556 CGCGGGAGAGGCGGCGGCGGGGG + Intergenic
1057463771 9:95292423-95292445 CGGGCCCGAGGCGGCGGCGGAGG - Intronic
1057643781 9:96854184-96854206 GGCGCGAGCGGCGGCGGGGGTGG - Exonic
1057869706 9:98708673-98708695 CGCGCGGGCGGCGGTGGCGGCGG + Exonic
1058885794 9:109320554-109320576 CCCGCGAGAGGCGGCGCGGGCGG - Exonic
1061000439 9:127899468-127899490 CGCGCGGGAGCAGGCCGCGGGGG - Intronic
1061102748 9:128504646-128504668 CGCGGGAGCGTCGCCGGAGGTGG + Intergenic
1061553660 9:131352523-131352545 CGCCTGAGAGTAGGAGGCGGAGG + Intergenic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062653529 9:137590425-137590447 CGGGCGCGAGGCGGCGGCGGAGG - Exonic
1203469840 Un_GL000220v1:111580-111602 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1203477661 Un_GL000220v1:155552-155574 CGCCCGTGGGTCGGGGGCGGTGG + Intergenic
1185505467 X:630131-630153 CGCTTGGGAGGCGGCGGCGGCGG - Intronic
1189446479 X:41085606-41085628 TGAGAGAGAGGCGGCGGCGGCGG - Intergenic
1190726399 X:53193267-53193289 CCCTGGAGAGGCGGCGGCGGCGG - Exonic
1191701134 X:64044047-64044069 CGCTCGAGAGTGGGAGGCGAAGG + Intergenic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192260976 X:69505656-69505678 CGGCCGAGAGCCGGCGGCGGGGG - Exonic
1195138205 X:101931888-101931910 CGCGGCAGCGGCGGCGGCGGCGG - Intronic
1197446008 X:126552757-126552779 CGCGCGGGAGAGGGCGGCGGTGG + Exonic
1198276335 X:135098381-135098403 CGAGTGAGCGCCGGCGGCGGCGG - Intergenic
1198310174 X:135422362-135422384 CGAGTGAGCGCCGGCGGCGGCGG + Intergenic