ID: 1010705102

View in Genome Browser
Species Human (GRCh38)
Location 6:79099040-79099062
Sequence TTATATAGACTTCAGTGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010705097_1010705102 25 Left 1010705097 6:79098992-79099014 CCAGCAGGCATTATACCTACTGG No data
Right 1010705102 6:79099040-79099062 TTATATAGACTTCAGTGACAGGG No data
1010705099_1010705102 10 Left 1010705099 6:79099007-79099029 CCTACTGGTAGTGAGAATATCAT No data
Right 1010705102 6:79099040-79099062 TTATATAGACTTCAGTGACAGGG No data
1010705096_1010705102 28 Left 1010705096 6:79098989-79099011 CCTCCAGCAGGCATTATACCTAC No data
Right 1010705102 6:79099040-79099062 TTATATAGACTTCAGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010705102 Original CRISPR TTATATAGACTTCAGTGACA GGG Intergenic
No off target data available for this crispr