ID: 1010707167

View in Genome Browser
Species Human (GRCh38)
Location 6:79128456-79128478
Sequence TGGAATATGAATAAGAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010707165_1010707167 30 Left 1010707165 6:79128403-79128425 CCAGCAAGGGTTCTGAACTGAAC No data
Right 1010707167 6:79128456-79128478 TGGAATATGAATAAGAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010707167 Original CRISPR TGGAATATGAATAAGAATGA AGG Intergenic
No off target data available for this crispr