ID: 1010712913

View in Genome Browser
Species Human (GRCh38)
Location 6:79196100-79196122
Sequence CTTTATTAGCAGCAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010712913_1010712918 15 Left 1010712913 6:79196100-79196122 CCATTCTCCTGCTGCTAATAAAG No data
Right 1010712918 6:79196138-79196160 GGCAATTTATAAAGAAAAAGAGG 0: 47
1: 1494
2: 1591
3: 1148
4: 1456
1010712913_1010712916 -6 Left 1010712913 6:79196100-79196122 CCATTCTCCTGCTGCTAATAAAG No data
Right 1010712916 6:79196117-79196139 ATAAAGACATACATGAACCTGGG No data
1010712913_1010712919 23 Left 1010712913 6:79196100-79196122 CCATTCTCCTGCTGCTAATAAAG No data
Right 1010712919 6:79196146-79196168 ATAAAGAAAAAGAGGTTTAATGG 0: 1338
1: 1566
2: 1040
3: 923
4: 2126
1010712913_1010712915 -7 Left 1010712913 6:79196100-79196122 CCATTCTCCTGCTGCTAATAAAG No data
Right 1010712915 6:79196116-79196138 AATAAAGACATACATGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010712913 Original CRISPR CTTTATTAGCAGCAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr