ID: 1010713417

View in Genome Browser
Species Human (GRCh38)
Location 6:79202344-79202366
Sequence CAGAGGTGCTAAAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010713417_1010713421 -6 Left 1010713417 6:79202344-79202366 CCTTCTTCCCTTTAGCACCTCTG 0: 1
1: 0
2: 2
3: 32
4: 344
Right 1010713421 6:79202361-79202383 CCTCTGCTAATCTTTGCTCCAGG 0: 1
1: 1
2: 1
3: 10
4: 169
1010713417_1010713422 10 Left 1010713417 6:79202344-79202366 CCTTCTTCCCTTTAGCACCTCTG 0: 1
1: 0
2: 2
3: 32
4: 344
Right 1010713422 6:79202377-79202399 CTCCAGGTTCTTTCTAACAGAGG 0: 1
1: 0
2: 1
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010713417 Original CRISPR CAGAGGTGCTAAAGGGAAGA AGG (reversed) Exonic
900265644 1:1755790-1755812 CACAGGTGCTAATGGGGAGATGG + Intronic
900565295 1:3329085-3329107 CAGAGGTGGTGAGTGGAAGAGGG - Intronic
900760535 1:4467353-4467375 CAGAGGGGCTGCAGGGGAGAAGG + Intergenic
900993464 1:6108288-6108310 GAGAGATGATAGAGGGAAGATGG + Intronic
901465427 1:9418098-9418120 GAGAGATGCTGATGGGAAGAGGG - Intergenic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
902121882 1:14173288-14173310 CAGATGGGCTAAAGAAAAGAAGG + Intergenic
903185212 1:21624944-21624966 CTGAGATGCTCAGGGGAAGAGGG + Intronic
903587720 1:24428910-24428932 CAGAGCTGCAGAAGGGCAGAGGG - Intronic
904462171 1:30686583-30686605 GAGAGCTGCGAAAGGGAGGAGGG - Intergenic
904894300 1:33802558-33802580 CAGAGGTCCTACAAGGGAGATGG + Intronic
906658312 1:47564770-47564792 CAGAGGAAGTAAAGGGGAGAAGG + Intergenic
907556736 1:55350624-55350646 CAGAGGTGCTAAGGAGGAGATGG + Intergenic
907573543 1:55505783-55505805 CAGACATGAGAAAGGGAAGAGGG - Intergenic
908110984 1:60897166-60897188 CAGCAGTGCTAATGGGAAGTTGG - Intronic
909195068 1:72609494-72609516 AAGAGATGCAGAAGGGAAGAGGG + Intergenic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
910963685 1:92786640-92786662 GAGAGGGGATAAAGGGAATATGG - Intronic
912000511 1:104828654-104828676 CAGAGGTGGAAAAGGGAACATGG - Intergenic
913471240 1:119189108-119189130 GGGAGTTGCTAAAGGAAAGAAGG - Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
914407473 1:147390047-147390069 CAGCAGTGCTTAGGGGAAGAGGG - Intergenic
915062648 1:153198977-153198999 CAGAGGACCAAAAGGGAAGAGGG + Intergenic
915541206 1:156567391-156567413 CAGAGGTGAAGTAGGGAAGATGG - Intronic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
916266346 1:162893273-162893295 CAGAGGAGAGAAAGGGATGAAGG - Intergenic
916316544 1:163454699-163454721 CACAGGTGCCAATGGGGAGAGGG + Intergenic
917123153 1:171661912-171661934 GAAAAGAGCTAAAGGGAAGATGG + Intergenic
920708856 1:208275874-208275896 CAGTTGTGCCCAAGGGAAGAGGG - Intergenic
920764192 1:208815965-208815987 CAGAAAGGCAAAAGGGAAGAAGG + Intergenic
920837245 1:209522543-209522565 TAGAGGAGATAAAGGGAAGGGGG + Intergenic
922033854 1:221829270-221829292 CAGAGGTGCCCATGTGAAGATGG - Intergenic
922061418 1:222096306-222096328 CAGATGTGCTGAAAGGCAGAGGG - Intergenic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
922529534 1:226333775-226333797 CAAAGGTTCCAAAGGGAAAATGG - Intergenic
922918494 1:229278700-229278722 CAGAGGTGGTTAAAGGAGGAAGG - Intronic
924246745 1:242092830-242092852 CAGGGGTGCCAAATGGAAAAGGG - Intronic
924603236 1:245509856-245509878 CAGAGGAGCTGAAGGCAGGAAGG - Intronic
1062981116 10:1723873-1723895 CAGTGATGCTACAGGGATGAAGG + Intronic
1062990198 10:1807503-1807525 CAGAGATGGTACAGGGAACATGG + Intergenic
1063612321 10:7573188-7573210 CAAAGGTCCTAAAAGGGAGAAGG + Exonic
1064011536 10:11740368-11740390 CAGAGGTGCAATGGGGAAGATGG - Intergenic
1064199797 10:13274664-13274686 CAGAAAAGCAAAAGGGAAGAGGG - Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1065236413 10:23657318-23657340 CAGAGTCTCTATAGGGAAGAGGG - Intergenic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065751841 10:28894868-28894890 GAGAGCTGGTAAAGGAAAGATGG + Intergenic
1065760292 10:28975538-28975560 TAGAAGTGCTAAAGGAGAGATGG - Intergenic
1067024352 10:42830677-42830699 CAGAGGTGGTAAAGGTAAAATGG + Intronic
1067203514 10:44194867-44194889 AAGAGGTGATTAAGGTAAGATGG - Intergenic
1067411737 10:46070644-46070666 CAGTGGTGCTGAAAGGAAGCAGG + Intergenic
1067781944 10:49214089-49214111 CAGGGGGCCTAAAGGGAAAATGG - Intergenic
1068572042 10:58640488-58640510 AAGAGGTCACAAAGGGAAGAAGG - Intronic
1069029163 10:63577404-63577426 CAGGGGTGCTAAAGTTAGGAAGG - Intronic
1069454680 10:68544801-68544823 CAAAGGCACTAATGGGAAGAGGG + Intergenic
1070369667 10:75770513-75770535 AAGAACTGCTATAGGGAAGAAGG - Intronic
1072221959 10:93334275-93334297 CAGAGGTGCTACAGGAAAAGCGG - Intronic
1073546323 10:104352661-104352683 CAGAGGTCCTTAAGGGACCACGG + Intergenic
1078720501 11:13879624-13879646 CAGAGGTGCCAAAGGAGAGAGGG - Intergenic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1078877241 11:15410993-15411015 CTGAGGTGCTAAAGTGTAAAGGG + Intergenic
1079408853 11:20167800-20167822 CATAGGTGTGAAAGGGCAGAAGG - Intergenic
1079424034 11:20323429-20323451 CAGAGAGGCAAAAAGGAAGAAGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1083157815 11:60836117-60836139 AAGAGGTACAACAGGGAAGAGGG - Intergenic
1084154934 11:67308097-67308119 CAGAGGTCCCAGAGGGAAGGTGG + Intronic
1086423951 11:86665661-86665683 GAGAGGCGCTAAAGGGAAAGAGG + Intronic
1087369311 11:97261629-97261651 CAGAGGTGCCCGAGGGAAGATGG - Intergenic
1087696478 11:101382775-101382797 CAGAGAAGCGAAAGGGAAGCAGG - Intergenic
1087907240 11:103712723-103712745 CAAAGTTGCTAAAGGGCAGCTGG + Intergenic
1088106539 11:106212830-106212852 CAGAGAGGCTACAGGGAAGCAGG + Intergenic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1091070620 11:132559184-132559206 GAGAGGAGCCAAAGGGAGGAAGG + Intronic
1091655464 12:2343155-2343177 GGGAGTTGCTAAAGGGAAGAAGG - Intronic
1092170335 12:6370372-6370394 AAGAGGGGCTAGAGGGGAGAGGG - Intronic
1092292839 12:7174087-7174109 CAAATGTGGTAAAGGAAAGAAGG - Intergenic
1092521615 12:9280456-9280478 AAGAGTTGGAAAAGGGAAGAGGG + Intergenic
1092998536 12:13973882-13973904 CATTGGTGCCTAAGGGAAGATGG - Intronic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1096335285 12:50750719-50750741 CACTGGTGGTAAAGGGCAGAAGG - Intergenic
1098413352 12:70204895-70204917 CGGGGGTGCTAAAGGGAATTTGG + Intergenic
1098530625 12:71537670-71537692 TAGACGTGCTTAAAGGAAGAAGG - Intronic
1098661619 12:73101440-73101462 GAGAGGTCCCAAAGGGAAAAGGG - Intergenic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1101266401 12:103092917-103092939 CAGAAGTGAAACAGGGAAGAGGG - Intergenic
1102957728 12:117070238-117070260 CAGGGCTGCTCAGGGGAAGATGG + Intronic
1105604878 13:21919090-21919112 CCAAAGTCCTAAAGGGAAGAGGG - Intergenic
1105867706 13:24475173-24475195 GACAGGTGCTAAAGAGAAAAAGG - Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1108504222 13:51096223-51096245 CAGAGGGGCAAAAGTGAGGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111875217 13:93884989-93885011 TAGAGGTGGGAAAGGGAAGTGGG + Intronic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1114852901 14:26401840-26401862 TAGAAGTGCTAAGGGGCAGATGG - Intergenic
1115133349 14:30079497-30079519 CCGAGGTGCTAAAGGCAAGGGGG + Intronic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1117620136 14:57577097-57577119 AAGAGGAGCCAAAGGCAAGATGG + Intronic
1117746884 14:58878836-58878858 CAGTGGTGGTAAAGGTGAGAAGG + Intergenic
1118438076 14:65789541-65789563 GAGAGGTGCAGAGGGGAAGAGGG - Intergenic
1118748142 14:68788961-68788983 GAGAGGTGCCACCGGGAAGAGGG + Exonic
1119167883 14:72510668-72510690 CTGAGAAGCTAAACGGAAGAGGG + Intronic
1119527286 14:75332917-75332939 CAAAGGAGATAAAGTGAAGAAGG + Intergenic
1119875182 14:78053540-78053562 AAGAGGTCTTAAAGAGAAGATGG - Intergenic
1120279456 14:82420624-82420646 TACAAGTGCTAAAGGAAAGAAGG - Intergenic
1121193835 14:92052653-92052675 CAAAAGTGGTAAAGGGATGAGGG - Exonic
1122175520 14:99915560-99915582 CAGAGCTGCTACAGGGATTAAGG - Intronic
1122324784 14:100875626-100875648 GAGGGGTGAGAAAGGGAAGATGG - Intergenic
1122782509 14:104149643-104149665 CAGAGGGGCAACAGGGAAAAGGG - Intronic
1122796734 14:104209871-104209893 CAGAGGTGCTAAATCGATGCAGG + Intergenic
1124133424 15:27010648-27010670 CAGAGATGAGAAAGGGGAGAGGG - Intronic
1125478696 15:40065040-40065062 CAGAGATGGGAAAAGGAAGAAGG + Intergenic
1126755680 15:51923018-51923040 CAGAGGTGTGATGGGGAAGATGG - Intronic
1127696196 15:61450193-61450215 CAGAGGTTCTCAAGGTTAGAAGG + Intergenic
1128341943 15:66828526-66828548 CTGAGGACCTAAAAGGAAGAAGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129909517 15:79214609-79214631 CAGATGTGCTAGGGTGAAGATGG + Intergenic
1129915555 15:79266894-79266916 CAGAGGTGGTACAGGGACAATGG - Intergenic
1132348682 15:101123780-101123802 CAGAGGGACAAAAGCGAAGATGG - Intergenic
1132503192 16:293653-293675 CAGGGGTGCTCAAGGGACAAGGG + Exonic
1132804008 16:1767398-1767420 CATAGGTGGTACAGGGGAGATGG - Intronic
1133943816 16:10332063-10332085 CATAGGAGCTAAAGGGGAGCTGG - Intronic
1134297940 16:12963119-12963141 CAGAGGTGCCTGAGGGAAGCAGG + Intronic
1135087757 16:19488494-19488516 CAGTGGAGCCAAAGGGAAGTGGG - Intronic
1135170873 16:20182240-20182262 CAGAGGAGCCAAAGAAAAGAAGG + Intergenic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1136096310 16:27959569-27959591 CAGAAGGGCAAAAGGGAGGACGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1136536635 16:30903398-30903420 CAGAGGGGCTGAAGGAAAGGAGG - Exonic
1137672970 16:50290287-50290309 CAGAGGTGACAAAGGCCAGAAGG + Intronic
1140280865 16:73554449-73554471 CTGAAGTGCTGAAGGCAAGATGG - Intergenic
1141799064 16:86295027-86295049 CAGAGGTCCTAAAGGGTGAAGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141924329 16:87157421-87157443 CTGGTGTGCTAATGGGAAGAAGG + Intronic
1142057498 16:88007475-88007497 CAGAGGCTCTCAGGGGAAGACGG - Intronic
1142283492 16:89161216-89161238 GGGAGGTGCTGAAGGGATGAAGG - Intergenic
1142964499 17:3572270-3572292 CAGAGGAGCTGAGGGGCAGAGGG + Intronic
1143492130 17:7290630-7290652 TAGAGGAGCTAAAGGAAAGCTGG - Intronic
1143539097 17:7558940-7558962 CAGTGGTGCAGAAGGGAAGAAGG - Exonic
1144613260 17:16744326-16744348 CAGAGCTGCTACAGTGAAAAGGG - Intronic
1144899479 17:18570982-18571004 CAGAGCTGCTACAGCGAAAAGGG + Intergenic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146472150 17:33133216-33133238 CAAAGGTGGGGAAGGGAAGAGGG + Intronic
1146913793 17:36665264-36665286 CAGAGGTGGGGAAGGGAAGGGGG - Intergenic
1147595042 17:41711690-41711712 CAGAGGGCCTAAGGAGAAGAAGG + Intergenic
1147792936 17:43024821-43024843 GAGAGATGCTAAGGGGAAGGAGG - Intronic
1147798484 17:43063830-43063852 CTGAGGTGTTAAAGGGAGGAGGG + Intronic
1148049328 17:44761383-44761405 CAGAGGTGGCAAAGGGTAGGAGG + Intronic
1150535680 17:66037346-66037368 GAGAGGTGGTCACGGGAAGAAGG - Intronic
1150866838 17:68860241-68860263 AAGAGATGCTAAAGAGAACAGGG - Intergenic
1151349708 17:73524566-73524588 CAGTCATGCTAGAGGGAAGAGGG - Intronic
1153173837 18:2347768-2347790 CACTGGTGCTTAAGGGAAAAAGG - Intergenic
1157234296 18:45948905-45948927 CAGAAGTGCTAAAGAAAAGGAGG + Intronic
1157722417 18:49935568-49935590 CAGATGTGCTGAAGGCAAGGTGG + Intronic
1158667981 18:59449939-59449961 CAGAGGGGCTGAAGGGAACCAGG - Intronic
1159313152 18:66736502-66736524 TTGAGGTCCTAAAGGAAAGAAGG - Intergenic
1159547755 18:69861711-69861733 CATAGGTGCAAAAGAGTAGAGGG + Exonic
1163217327 19:15890468-15890490 GAGAGGTGCTCAAGGGAGCAAGG - Intronic
1164400255 19:27897255-27897277 CAGAGGAGCAAAGGGGAAGCTGG - Intergenic
1164648711 19:29876786-29876808 CAGAGGGGCTGAAGAGAGGAGGG - Intergenic
1164735875 19:30540523-30540545 CTGAGGTGCTGTAGGGATGAAGG - Intronic
1165176511 19:33934377-33934399 CAGAGGTGGCCAAGGGAAGGTGG + Intergenic
1165213531 19:34254008-34254030 CTGAGGTCCTAAGGGGTAGAAGG - Intergenic
1166251899 19:41577031-41577053 CAGAGGTACTGAAGGAATGAGGG + Intronic
1166371915 19:42306676-42306698 CAGGCGTGCCAAAGGGAAGAAGG - Intronic
1166979015 19:46621859-46621881 CAGAGATGCCTAAGGGGAGAGGG + Intronic
1167602492 19:50462503-50462525 CAGAGGAGCTAACAGGAAGTGGG - Intronic
1168647721 19:58071502-58071524 CACAGGTAGTAAAGGGAAGGAGG - Intronic
925333543 2:3076852-3076874 CAGAGACCCTCAAGGGAAGAAGG + Intergenic
927050570 2:19324222-19324244 CAGAAGGGATAAAGGAAAGAAGG + Intergenic
927187566 2:20492587-20492609 CAGTGGTGTTAATGGGGAGATGG + Intergenic
928994441 2:37272011-37272033 CAGAAGTGCTGAATGGATGAGGG - Intronic
931092161 2:58897863-58897885 CAGAACTGCCAAACGGAAGAAGG - Intergenic
931231165 2:60376051-60376073 CAGAGCTCCCCAAGGGAAGAAGG - Intergenic
931717249 2:65038887-65038909 CAGCAGTGCTAACTGGAAGAAGG - Intergenic
931815560 2:65897364-65897386 CATATGAGCTAAGGGGAAGATGG - Intergenic
933243851 2:79953231-79953253 GAGAGGTGCCAAACGTAAGAAGG - Intronic
933544816 2:83696452-83696474 CATCTGTTCTAAAGGGAAGAAGG - Intergenic
933995822 2:87669045-87669067 CAGAGGTGGAAAAGGCAACATGG + Intergenic
934701795 2:96447837-96447859 CACAGGTACAAAAAGGAAGAAGG - Intergenic
935748238 2:106208386-106208408 TAGATGAGCTAATGGGAAGATGG + Intergenic
936298035 2:111281867-111281889 CAGAGGTGGAAAAGGCAACATGG - Intergenic
936373948 2:111925103-111925125 CCCAGGAGCTAAAGGGGAGATGG - Intronic
936495373 2:113015855-113015877 CAGAGATACTCAAGGAAAGAAGG - Intergenic
936842036 2:116781402-116781424 CACATGTGCCAAAGGGAAAATGG - Intergenic
937739066 2:125327460-125327482 AAGAGATGCTAATGGGAAAAGGG + Intergenic
937822634 2:126328050-126328072 AAGAGGTAATAAAGGGAATAAGG - Intergenic
938195240 2:129321083-129321105 CAAAGATGTTTAAGGGAAGATGG - Intergenic
939592377 2:144081658-144081680 AAGAGGAGGGAAAGGGAAGAGGG + Intronic
939808599 2:146805160-146805182 TAGATGTGGAAAAGGGAAGAGGG + Intergenic
940170169 2:150820470-150820492 CAGAAGTGCTAAAATGAAGGTGG + Intergenic
940581856 2:155590335-155590357 CAGAGATGCTAATTGGAAGGAGG + Intergenic
940613679 2:156023511-156023533 TAGAAGTGCTAAAGGTAAGTAGG + Intergenic
945194048 2:207221673-207221695 CATAGGTCCTAAAAAGAAGAAGG + Intergenic
946359112 2:219208375-219208397 CAGAGGTGTGAAGGGGAAAAAGG - Intronic
946663912 2:222029684-222029706 CAGTGTTCCTCAAGGGAAGAGGG + Intergenic
947263521 2:228251673-228251695 AAAAGGAGCTAAAGGGAAGAGGG + Intergenic
947679285 2:232014975-232014997 CAGAGGTAGTAAAAGGAAAATGG + Exonic
948002858 2:234582430-234582452 CAGAGGAGGCAAAGGAAAGAGGG - Intergenic
948174592 2:235933280-235933302 GAGAGGAGGAAAAGGGAAGATGG + Intronic
948647824 2:239419257-239419279 CAGAGATGCTGGAGGGGAGATGG + Intergenic
1169903844 20:10580568-10580590 CAGAGGAGTTAAAGGTAGGATGG - Intronic
1172554893 20:35832264-35832286 CAGAGGTGCAAAAGGGGAGAGGG - Intronic
1173873899 20:46357834-46357856 CAGAGGGGCGAAGAGGAAGAGGG - Intronic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175773547 20:61638762-61638784 CAGAGGTGCTCTATGGGAGATGG + Intronic
1176380936 21:6111704-6111726 CAGAGGTGCTAAAGGGGTCGAGG + Intronic
1177540473 21:22486989-22487011 CAGAGGTTGGAAAGGGTAGAAGG - Intergenic
1178096169 21:29218026-29218048 CAAAGGCGTTAAAGAGAAGAAGG - Intronic
1179246415 21:39637729-39637751 CAGAGGTGCTAGAGAGACAATGG + Intronic
1179403908 21:41109875-41109897 AGGAGGAGCTAAAAGGAAGAAGG + Intergenic
1179637708 21:42724097-42724119 CAGAGGTGCTAGAGGGGGTAAGG + Intronic
1179742536 21:43426536-43426558 CAGAGGTGCTAAAGGGGTCGAGG - Intronic
1179955803 21:44737534-44737556 CAGTGGTGTGTAAGGGAAGAGGG - Intergenic
1182473976 22:30565858-30565880 CAGCAGTGCTGAAGGGAGGATGG - Intronic
1182750490 22:32637973-32637995 CTGAACTACTAAAGGGAAGAGGG - Intronic
1182970041 22:34565127-34565149 CACAGGAGCAAAAGAGAAGATGG - Intergenic
1184944573 22:47794045-47794067 CACAGGTGCTGATGGGGAGATGG - Intergenic
949421525 3:3871516-3871538 CAGAGATGCCAGAGGGAACATGG - Intronic
949976687 3:9467298-9467320 CTTAAGTGCTAAGGGGAAGAAGG + Intronic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
950260029 3:11536815-11536837 CACAGCTGCTGAAGGGAAGATGG - Intronic
954195430 3:48994053-48994075 CAGATGTGTGAGAGGGAAGAGGG + Intronic
954948339 3:54446401-54446423 CACAGGTGGTGAAGGGCAGAGGG + Intronic
955320000 3:57967639-57967661 CTGAGGGGCAAAAGGCAAGAAGG + Intergenic
956387559 3:68736532-68736554 CAGAAAAGCTAAAGGTAAGATGG - Intronic
956724634 3:72146675-72146697 CAGAGGTGGGCAACGGAAGACGG + Intergenic
958018638 3:87970960-87970982 CAGAGTTGCTATAGGAAGGAAGG - Intergenic
961392529 3:126562635-126562657 TAGAAATGCTAAAGGGAAAAGGG - Intergenic
961545735 3:127631566-127631588 TATAGGTGCTAGAGGGAAAAAGG + Intronic
961563697 3:127748364-127748386 CAGAGGTGGGAGAGGGAGGAGGG + Intronic
961989283 3:131170443-131170465 CATAGGTGCCAAATTGAAGAAGG + Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
963367266 3:144352173-144352195 CTGAGCAGCAAAAGGGAAGACGG - Intergenic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
966325733 3:178751668-178751690 CAAAGGTACAATAGGGAAGAGGG + Intronic
966653623 3:182328176-182328198 CACTGGTCTTAAAGGGAAGATGG + Intergenic
967271517 3:187737194-187737216 CAAAAGAGCTAAAGGGAGGAAGG - Intronic
967868056 3:194206461-194206483 AAGAAGTGCCAACGGGAAGAAGG + Intergenic
968679742 4:1909185-1909207 AAGAGGTGCTCAAGGGCTGACGG - Intronic
969337391 4:6519702-6519724 CAGAGGAGCTAACAGGGAGAGGG + Intronic
969685572 4:8672195-8672217 GAGAGGGGATAAAGGGAGGATGG + Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
971149869 4:24020689-24020711 CAGAGATGAGAAAGGGAAGGGGG + Intergenic
973721846 4:53731764-53731786 CAGAAGTGAGAAAGGGAAGGAGG + Intronic
974183567 4:58415587-58415609 CAGAGGTGCCAAAAGCCAGAGGG + Intergenic
974417350 4:61627077-61627099 CAGAGGCAATAAAGGGTAGAGGG - Intronic
974699886 4:65427618-65427640 CAAAGGTGGAAAAGGGAAGAGGG + Intronic
975810890 4:78168434-78168456 CAGGGGTGCTGCAGGGAAGTGGG - Intronic
975973919 4:80073333-80073355 CAGATTTGGGAAAGGGAAGAAGG + Intronic
976137623 4:81955895-81955917 CAGAGGGGCTAAGGGAAACAAGG - Intronic
976565255 4:86545697-86545719 GAGAGGTGTTAATGGAAAGAAGG + Intronic
977780681 4:100977398-100977420 CAGGGGTGATAAAGGTAAAAAGG + Intergenic
978622026 4:110641999-110642021 CAGATGTGCCAAAGGTCAGAGGG - Intronic
978814215 4:112884849-112884871 CAAAGGTGCTAAAGGGAATTTGG - Intronic
982693954 4:158579060-158579082 CAGAGATGCTGGAGAGAAGAGGG + Intronic
982925890 4:161336442-161336464 CAGAGGTGAGAAGGGGAAGTTGG + Intergenic
983311931 4:166075856-166075878 CAAAGGAGCTAAATGGAACAAGG - Intronic
984573934 4:181425636-181425658 GAGAGGTGTTAAAATGAAGATGG + Intergenic
986302455 5:6489091-6489113 AAGAGTTGCTAAAAGGATGAAGG - Intronic
987683778 5:21170275-21170297 CAGAGGTACTTAAGGAAAGCAGG + Intergenic
988490391 5:31700712-31700734 CTGAGGAGGAAAAGGGAAGAAGG + Intronic
988974878 5:36505158-36505180 CAGTGGGGGTAAAGGGAACATGG + Intergenic
990782345 5:59379261-59379283 CAGTGGTGCTAAAAGTCAGAAGG - Intronic
991550071 5:67826091-67826113 CAGAAGTGGCAAAGGGAACAAGG + Intergenic
992156178 5:73957431-73957453 AACAGGAGCTAAAGGGAAGTAGG - Intergenic
993336649 5:86667905-86667927 CAGAAGTTCTAAAGGGCATATGG - Intergenic
995289560 5:110435605-110435627 CAGAGGTAGTGAAGGGTAGAGGG - Intronic
995372722 5:111437709-111437731 CAGAGGTGAGAAAGAGATGAAGG + Intronic
995653093 5:114393732-114393754 CAGATTTGTTAAAGGGGAGATGG - Intronic
996513922 5:124348753-124348775 AAGAGTTGCTAAAGGCAATATGG + Intergenic
996760529 5:126982293-126982315 CAGACATGGTATAGGGAAGATGG - Intronic
997567270 5:134898047-134898069 CAGTGGTGCTGAAGGGAGGCTGG - Intronic
998218240 5:140253768-140253790 CAGAGAAGATTAAGGGAAGAAGG + Intronic
999619714 5:153460371-153460393 CAGAGGTGCCAATGGGAGCAAGG - Intergenic
1002940873 6:1714652-1714674 CAGAGTGGGTAAAGGAAAGATGG + Intronic
1003409530 6:5850625-5850647 CCGTGGTGCAAACGGGAAGAAGG + Intergenic
1007498242 6:42276577-42276599 CAACGGTGCTAAAAAGAAGACGG - Intronic
1010006070 6:70997080-70997102 CAGAGGCGGTAAAGAGAAGGTGG + Intergenic
1010713417 6:79202344-79202366 CAGAGGTGCTAAAGGGAAGAAGG - Exonic
1011752106 6:90463790-90463812 CAGAGATGTGAAAGGGAAGAAGG - Intergenic
1012222539 6:96666953-96666975 CAGACATGCCAAAGGTAAGATGG + Intergenic
1013003236 6:106046070-106046092 CAGAGCTGCTTTAGAGAAGAAGG + Intergenic
1013623074 6:111909222-111909244 CAGAGGTGCAGGAGGGCAGAAGG - Intergenic
1014219750 6:118788028-118788050 AAGAGATGCTAATGGGAAAAGGG - Intergenic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1019690698 7:2409657-2409679 CGGAGGTGAGAAAGGGAAGCAGG + Intronic
1019845125 7:3491233-3491255 CACAGGTGCTTAAGGAACGATGG - Intronic
1020033050 7:4946435-4946457 CAGTGATGCTGAAGGGAAGTGGG + Intronic
1020080236 7:5282843-5282865 GAGAGGAGCGAGAGGGAAGAGGG + Intronic
1020976626 7:15014455-15014477 ATGAGGTCCTAAAGGGAAGTGGG + Intergenic
1021029991 7:15720715-15720737 CAGAGGTTCTTTAGGGAACAAGG - Intergenic
1021590998 7:22261786-22261808 CAAAGGTGCAAAAGGAAAGATGG + Intronic
1022769399 7:33453249-33453271 CAGCTGAGTTAAAGGGAAGAAGG + Intronic
1023120925 7:36907588-36907610 CAGAGGAGCAGAAAGGAAGAGGG - Intronic
1023529812 7:41140590-41140612 CAGGGGTGCTCAAGGCCAGAAGG + Intergenic
1024268758 7:47626412-47626434 CAGAGGTGCAAAAGGGAGGGTGG + Intergenic
1027529492 7:79312910-79312932 CATACAAGCTAAAGGGAAGAAGG - Intronic
1028463348 7:91120932-91120954 CAGAAAAGCTACAGGGAAGATGG + Intronic
1029225267 7:99022410-99022432 CAGAGGTGAAACAGGGAAGGTGG + Intergenic
1029811995 7:103058525-103058547 CAGAAGTGCTAGAGAGCAGATGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1029982858 7:104895540-104895562 CAGAGGTGCAACAGGGAAAAGGG + Intronic
1030333934 7:108303379-108303401 CAGAGGGGCTGAAGAGGAGACGG - Intronic
1030591792 7:111490978-111491000 AAGAGGTGGGAAAGGGAAGCAGG - Intronic
1030689486 7:112517753-112517775 CAGTGGTGGTAAAGGGGTGATGG + Intergenic
1030759612 7:113334197-113334219 CAGAGGTGCAAAAGGGAGCTGGG + Intergenic
1031075608 7:117209278-117209300 CTCAGGTGCTACAGGGAGGAAGG - Intronic
1031843616 7:126777226-126777248 CAGAGAAGTGAAAGGGAAGAGGG + Intronic
1032882342 7:136103062-136103084 CAGAGCAGTTAAAGGGAAGGAGG + Intergenic
1034422069 7:150995646-150995668 CAGGGGTGGGAGAGGGAAGAGGG - Intronic
1034896947 7:154882210-154882232 CCGAGGTGCCAAAGGGAAAGGGG + Intronic
1035610318 8:957995-958017 CAGAGTTTCTACAGGGATGACGG - Intergenic
1035670485 8:1413184-1413206 CAAAGGTGCTACAGAGAGGAGGG - Intergenic
1036673328 8:10807807-10807829 CAGAGGAGCTAAAAGGAGCAAGG + Intronic
1036693036 8:10956740-10956762 CAGAGGTGCAAAGGGGCAGCCGG - Intronic
1037156693 8:15709476-15709498 CAGAGGAGCAAAAATGAAGAAGG - Intronic
1038655272 8:29445012-29445034 CAGGGGTGGAAAAGGGAAGTTGG - Intergenic
1038972556 8:32652861-32652883 AAGAGTTGTTAAAAGGAAGAGGG - Intronic
1039864195 8:41487114-41487136 CAGAGAAGATACAGGGAAGAAGG + Intergenic
1040028256 8:42801357-42801379 GTGAGGTGGTAAAGGCAAGATGG + Intergenic
1040385771 8:46914150-46914172 CAGAGGTGCTGAGGGGAGGATGG - Intergenic
1040625911 8:49149842-49149864 CAGCAATGCTCAAGGGAAGAGGG + Intergenic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1041037500 8:53809452-53809474 GAGAGTCACTAAAGGGAAGAAGG + Intronic
1041777285 8:61537170-61537192 CAGAGAAGGTAAAGGGAAGATGG + Intronic
1042005546 8:64175905-64175927 GAGAGGTGCTAAGGGCATGAAGG - Intergenic
1043864242 8:85357639-85357661 CAGACTTCCTAAAGGGAAAAGGG + Intronic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1045112620 8:98948763-98948785 CGCAGGTGCCAAAGGGCAGAAGG + Intronic
1045151092 8:99409090-99409112 CAGAGTGGCTAAATGGAAGGTGG - Intronic
1045971217 8:108082138-108082160 CAAATGAGCTACAGGGAAGATGG + Intronic
1046940705 8:119928295-119928317 CAGAAGTTCTAAAGGCATGAAGG - Intronic
1047218916 8:122902907-122902929 CAGAGATGGTAATGGGAAGCTGG + Intronic
1047469164 8:125150806-125150828 CAGAGCTGCTTAATGGATGAGGG + Intronic
1047683769 8:127282467-127282489 CAGAGCTTCTAAGTGGAAGAGGG - Intergenic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048591796 8:135827160-135827182 AAGAGATGCTAAAGAGAAAAGGG - Intergenic
1048632520 8:136259576-136259598 CAGATGTGCTGAAGGGTACAGGG + Intergenic
1048819062 8:138363077-138363099 GAGAGATGCTAGGGGGAAGAGGG + Intronic
1049058131 8:140254919-140254941 CACAGGAGCTCAGGGGAAGACGG + Intronic
1049261398 8:141641116-141641138 CAGAGGTGCTCCAGGGAAAATGG - Intergenic
1051618845 9:19032138-19032160 CAGAGGAGCAACAGGCAAGAGGG - Intronic
1052269280 9:26609546-26609568 CAGAAATGCTAAAGGAAACAGGG + Intergenic
1052480981 9:29025801-29025823 CAGGGGTGGTTAAGGGTAGAGGG - Intergenic
1052782896 9:32798858-32798880 CAGAGGTTGAAAAGGGTAGAGGG + Intergenic
1055070136 9:72157586-72157608 CAGAGACACTAAAGGGTAGATGG - Intronic
1056122811 9:83505951-83505973 GAGAAATGCAAAAGGGAAGATGG + Intronic
1056243034 9:84668535-84668557 CCGAGCCGCAAAAGGGAAGACGG + Intronic
1057094752 9:92295589-92295611 AAGAGGAGAAAAAGGGAAGAGGG + Intergenic
1057241772 9:93417536-93417558 AAGAGATGCTAAAGGGAAGTGGG - Intergenic
1057700453 9:97360175-97360197 CAGTAGAGCCAAAGGGAAGAGGG + Intronic
1058506338 9:105669876-105669898 CAGAGGAGCTAAAAGCAAAAGGG - Intergenic
1061146312 9:128801194-128801216 CAGATGTGCTAATGGTAAGTAGG - Intronic
1062035262 9:134380061-134380083 CAGAGGGGCTGCAGGGGAGAGGG - Intronic
1062231537 9:135484718-135484740 CAGAGGGGCCACAGGGCAGAGGG + Exonic
1062318242 9:135978486-135978508 CAGGGCTGCTGAGGGGAAGATGG - Intergenic
1062318276 9:135978582-135978604 CAGGGCTGCTGAGGGGAAGATGG - Intergenic
1062324584 9:136005952-136005974 CAGAGGAGCAAAAGGGAATGGGG + Intergenic
1187075794 X:15933208-15933230 CAGGGGTGCTAAACTGAAAATGG - Intergenic
1187433846 X:19248905-19248927 CAGAGGTGGTGATGGGAGGAAGG - Intergenic
1189179107 X:38986767-38986789 CAGAGGGGCTGCAGGGAGGAGGG - Intergenic
1189304930 X:39979713-39979735 GAGAGTGGCTAAATGGAAGAGGG + Intergenic
1189685269 X:43557130-43557152 CATAGGTACTAACGGGAAGGTGG + Intergenic
1190146149 X:47893284-47893306 CAAAGGTGGTAAAAGGAAGAAGG + Intronic
1194263197 X:91723396-91723418 CAGAGTTGCTAAAAGGAATCTGG + Intergenic
1194643992 X:96435954-96435976 CTGAGGAGCAAAAGGGAAAAGGG - Intergenic
1195399467 X:104446264-104446286 CAAAGGGGCTGAAGGAAAGAGGG + Intergenic
1195671344 X:107472749-107472771 CAGAAGTGATAAAGGGAAAAAGG - Intergenic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1196068140 X:111488366-111488388 CAGAGGTGATAAGTGGGAGATGG + Intergenic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1198677851 X:139149886-139149908 CTCAGGTGATAATGGGAAGAAGG + Intronic
1198770312 X:140123864-140123886 CAGAGAGGCAAAAGGAAAGATGG - Intergenic
1199414427 X:147564663-147564685 CAGAGTTTCTAATTGGAAGAAGG - Intergenic
1200137494 X:153882160-153882182 CCGAGGGGTTAAAGGGCAGAGGG + Intronic
1200756216 Y:6992356-6992378 CAGAGGTGCACACAGGAAGAAGG - Intronic
1202088997 Y:21169502-21169524 CAGAGGTTGTAAAGTGTAGAGGG + Intergenic