ID: 1010723786

View in Genome Browser
Species Human (GRCh38)
Location 6:79311396-79311418
Sequence TAGCCAAGTCTACCACATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010723782_1010723786 20 Left 1010723782 6:79311353-79311375 CCATAAAGGTAAAGTATTCCTGG No data
Right 1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG No data
1010723785_1010723786 2 Left 1010723785 6:79311371-79311393 CCTGGCTCTCTGGAAAAGAATGC No data
Right 1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG No data
1010723781_1010723786 21 Left 1010723781 6:79311352-79311374 CCCATAAAGGTAAAGTATTCCTG No data
Right 1010723786 6:79311396-79311418 TAGCCAAGTCTACCACATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010723786 Original CRISPR TAGCCAAGTCTACCACATAG TGG Intergenic
No off target data available for this crispr