ID: 1010732784

View in Genome Browser
Species Human (GRCh38)
Location 6:79408914-79408936
Sequence AAGAACTATTCCTTCTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010732784_1010732788 20 Left 1010732784 6:79408914-79408936 CCTTCATAGAAGGAATAGTTCTT No data
Right 1010732788 6:79408957-79408979 AATTATATTCATTGCAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010732784 Original CRISPR AAGAACTATTCCTTCTATGA AGG (reversed) Intergenic
No off target data available for this crispr