ID: 1010732787

View in Genome Browser
Species Human (GRCh38)
Location 6:79408937-79408959
Sequence ATTCTGTCACAACTGCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010732787_1010732792 21 Left 1010732787 6:79408937-79408959 CCACTGGGCAGTTGTGACAGAAT No data
Right 1010732792 6:79408981-79409003 CCTTTCAAGTATTCACATTTGGG No data
1010732787_1010732790 20 Left 1010732787 6:79408937-79408959 CCACTGGGCAGTTGTGACAGAAT No data
Right 1010732790 6:79408980-79409002 CCCTTTCAAGTATTCACATTTGG No data
1010732787_1010732788 -3 Left 1010732787 6:79408937-79408959 CCACTGGGCAGTTGTGACAGAAT No data
Right 1010732788 6:79408957-79408979 AATTATATTCATTGCAAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010732787 Original CRISPR ATTCTGTCACAACTGCCCAG TGG (reversed) Intergenic