ID: 1010732787 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:79408937-79408959 |
| Sequence | ATTCTGTCACAACTGCCCAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010732787_1010732792 | 21 | Left | 1010732787 | 6:79408937-79408959 | CCACTGGGCAGTTGTGACAGAAT | No data | ||
| Right | 1010732792 | 6:79408981-79409003 | CCTTTCAAGTATTCACATTTGGG | No data | ||||
| 1010732787_1010732790 | 20 | Left | 1010732787 | 6:79408937-79408959 | CCACTGGGCAGTTGTGACAGAAT | No data | ||
| Right | 1010732790 | 6:79408980-79409002 | CCCTTTCAAGTATTCACATTTGG | No data | ||||
| 1010732787_1010732788 | -3 | Left | 1010732787 | 6:79408937-79408959 | CCACTGGGCAGTTGTGACAGAAT | No data | ||
| Right | 1010732788 | 6:79408957-79408979 | AATTATATTCATTGCAAGCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010732787 | Original CRISPR | ATTCTGTCACAACTGCCCAG TGG (reversed) | Intergenic | ||