ID: 1010734587

View in Genome Browser
Species Human (GRCh38)
Location 6:79429408-79429430
Sequence AGGGATGCCTGGCAGAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734587_1010734594 3 Left 1010734587 6:79429408-79429430 CCCTCTCTCTGCCAGGCATCCCT No data
Right 1010734594 6:79429434-79429456 GTGTCTAGGTTTCCCCTCTGCGG No data
1010734587_1010734595 11 Left 1010734587 6:79429408-79429430 CCCTCTCTCTGCCAGGCATCCCT No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734587 Original CRISPR AGGGATGCCTGGCAGAGAGA GGG (reversed) Intergenic
No off target data available for this crispr