ID: 1010734592

View in Genome Browser
Species Human (GRCh38)
Location 6:79429428-79429450
Sequence AGGGGAAACCTAGACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734592_1010734595 -9 Left 1010734592 6:79429428-79429450 CCTCCAGTGTCTAGGTTTCCCCT No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data
1010734592_1010734599 20 Left 1010734592 6:79429428-79429450 CCTCCAGTGTCTAGGTTTCCCCT No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734592 Original CRISPR AGGGGAAACCTAGACACTGG AGG (reversed) Intergenic
No off target data available for this crispr