ID: 1010734593

View in Genome Browser
Species Human (GRCh38)
Location 6:79429431-79429453
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734593_1010734599 17 Left 1010734593 6:79429431-79429453 CCAGTGTCTAGGTTTCCCCTCTG No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734593 Original CRISPR CAGAGGGGAAACCTAGACAC TGG (reversed) Intergenic
No off target data available for this crispr