ID: 1010734594

View in Genome Browser
Species Human (GRCh38)
Location 6:79429434-79429456
Sequence GTGTCTAGGTTTCCCCTCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734588_1010734594 2 Left 1010734588 6:79429409-79429431 CCTCTCTCTGCCAGGCATCCCTC No data
Right 1010734594 6:79429434-79429456 GTGTCTAGGTTTCCCCTCTGCGG No data
1010734589_1010734594 -8 Left 1010734589 6:79429419-79429441 CCAGGCATCCCTCCAGTGTCTAG No data
Right 1010734594 6:79429434-79429456 GTGTCTAGGTTTCCCCTCTGCGG No data
1010734587_1010734594 3 Left 1010734587 6:79429408-79429430 CCCTCTCTCTGCCAGGCATCCCT No data
Right 1010734594 6:79429434-79429456 GTGTCTAGGTTTCCCCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734594 Original CRISPR GTGTCTAGGTTTCCCCTCTG CGG Intergenic
No off target data available for this crispr