ID: 1010734595

View in Genome Browser
Species Human (GRCh38)
Location 6:79429442-79429464
Sequence GTTTCCCCTCTGCGGCTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734589_1010734595 0 Left 1010734589 6:79429419-79429441 CCAGGCATCCCTCCAGTGTCTAG No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data
1010734588_1010734595 10 Left 1010734588 6:79429409-79429431 CCTCTCTCTGCCAGGCATCCCTC No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data
1010734591_1010734595 -8 Left 1010734591 6:79429427-79429449 CCCTCCAGTGTCTAGGTTTCCCC No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data
1010734592_1010734595 -9 Left 1010734592 6:79429428-79429450 CCTCCAGTGTCTAGGTTTCCCCT No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data
1010734587_1010734595 11 Left 1010734587 6:79429408-79429430 CCCTCTCTCTGCCAGGCATCCCT No data
Right 1010734595 6:79429442-79429464 GTTTCCCCTCTGCGGCTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734595 Original CRISPR GTTTCCCCTCTGCGGCTAAG TGG Intergenic
No off target data available for this crispr