ID: 1010734598

View in Genome Browser
Species Human (GRCh38)
Location 6:79429448-79429470
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734598_1010734599 0 Left 1010734598 6:79429448-79429470 CCTCTGCGGCTAAGTGGTATACA No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734598_1010734603 16 Left 1010734598 6:79429448-79429470 CCTCTGCGGCTAAGTGGTATACA No data
Right 1010734603 6:79429487-79429509 TGCCAGGCTATGTCACTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734598 Original CRISPR TGTATACCACTTAGCCGCAG AGG (reversed) Intergenic
No off target data available for this crispr