ID: 1010734599

View in Genome Browser
Species Human (GRCh38)
Location 6:79429471-79429493
Sequence TAACACCCCTTCTATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010734596_1010734599 2 Left 1010734596 6:79429446-79429468 CCCCTCTGCGGCTAAGTGGTATA No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734597_1010734599 1 Left 1010734597 6:79429447-79429469 CCCTCTGCGGCTAAGTGGTATAC No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734593_1010734599 17 Left 1010734593 6:79429431-79429453 CCAGTGTCTAGGTTTCCCCTCTG No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734591_1010734599 21 Left 1010734591 6:79429427-79429449 CCCTCCAGTGTCTAGGTTTCCCC No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734589_1010734599 29 Left 1010734589 6:79429419-79429441 CCAGGCATCCCTCCAGTGTCTAG No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734598_1010734599 0 Left 1010734598 6:79429448-79429470 CCTCTGCGGCTAAGTGGTATACA No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data
1010734592_1010734599 20 Left 1010734592 6:79429428-79429450 CCTCCAGTGTCTAGGTTTCCCCT No data
Right 1010734599 6:79429471-79429493 TAACACCCCTTCTATGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010734599 Original CRISPR TAACACCCCTTCTATGTGCC AGG Intergenic
No off target data available for this crispr