ID: 1010740642

View in Genome Browser
Species Human (GRCh38)
Location 6:79499632-79499654
Sequence ATCTTCGGCTGGCAGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010740642 Original CRISPR ATCTTCGGCTGGCAGGACTA TGG Intronic
900125524 1:1067437-1067459 TACTTCGGCTGGCCGGACTACGG - Intergenic
900125821 1:1068610-1068632 TACTTCGGCTGGCCGGACTACGG + Intergenic
905043827 1:34980905-34980927 ATCTTAGGTTGGCAGGGCTGTGG - Intergenic
908875399 1:68668649-68668671 ATCTTCACATGGCAGGACAAAGG - Intergenic
915043172 1:152985390-152985412 ACCTTGGGCTGGCAGGGCTCAGG - Exonic
915043179 1:152985414-152985436 ACCTTGGGCTGGCAGGGCTCTGG - Exonic
915047713 1:153032505-153032527 ACCTTGGGCTGGCAGGGCTCGGG - Exonic
919967183 1:202539473-202539495 AGCTTCGTCTGGGAGGACTTAGG + Intronic
922659335 1:227416045-227416067 ATCTCCGGGTGCCAGGACTCTGG - Intergenic
1063118904 10:3090701-3090723 ATCTTTGACTGTCATGACTATGG - Intronic
1064578893 10:16773437-16773459 TTCTTCGACTGGAAGGAGTAAGG + Intronic
1066599637 10:37091006-37091028 ATATTAGGGTGTCAGGACTATGG - Intergenic
1072428630 10:95351800-95351822 ATATTCCCCTGGCAGGACCAGGG + Intronic
1075029529 10:119012781-119012803 ATCATCGGCTGCCTGGGCTATGG - Intergenic
1075038939 10:119092341-119092363 ATCTCCGGCTCCCAGAACTATGG + Intergenic
1076067575 10:127460944-127460966 AAATTCAGCTGGAAGGACTAAGG - Intergenic
1086956773 11:92941812-92941834 GTGTTCGGCAGGCAGGAGTAGGG + Intergenic
1086971603 11:93086672-93086694 ATCTTCGGCTGGCTGTGCTGTGG + Intergenic
1091910078 12:4223317-4223339 ATCTTTGGCTGGCAGAAGTCTGG + Intergenic
1093350181 12:18090249-18090271 ATTGTTGGCTGGCAGGAATATGG - Intronic
1093762932 12:22930461-22930483 GAGTTCGGCTGGCAGGACTGAGG - Intergenic
1108863591 13:54894289-54894311 AGGTTCCCCTGGCAGGACTAAGG - Intergenic
1110736642 13:78944508-78944530 ATTTTCTTCTGGCAGGACTTTGG - Intergenic
1111672410 13:91347917-91347939 ATCTTCGGCTGGCCGGCCGCGGG - Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1118344759 14:64929821-64929843 ATTTTCTGATGGCAAGACTAGGG + Intronic
1118457725 14:65959937-65959959 ATCTTGGCCTGGCAACACTAAGG - Intronic
1118520440 14:66576709-66576731 TTATTCTGCTGGCAGCACTAAGG - Intronic
1130374259 15:83314047-83314069 ATCTTTGGCTGGCAGAATCATGG + Intergenic
1131082238 15:89546378-89546400 TTCTTCGGCTGCCAGCACTTGGG + Intergenic
1133089285 16:3390907-3390929 ATCTTTGGGTGGCAGGGCTATGG - Intronic
1133618643 16:7504385-7504407 ATCTTAGGGTGGCAGGAACATGG + Intronic
1134135866 16:11676021-11676043 TTCCTCGGCTGGCAGCACTTTGG - Exonic
1134466330 16:14481865-14481887 ATCTTCTGCAGGGAGGATTATGG + Intronic
1146257315 17:31399018-31399040 ACCTTCGGCCGGCAGGAATAGGG + Intronic
1157686885 18:49650125-49650147 ATCAGTGGCTGCCAGGACTAGGG + Intergenic
1159415777 18:68146947-68146969 ATATACTGCTGGCAGGAGTAAGG + Intergenic
1161316072 19:3618244-3618266 ATCTGCGGTTGTCAGGACTAGGG + Intronic
932261639 2:70332251-70332273 GCCCTCAGCTGGCAGGACTAGGG - Intergenic
934028482 2:88019796-88019818 AACCTCTGCTGGCTGGACTAGGG - Intergenic
937253682 2:120540258-120540280 CTATTGGGCTGGCAGGTCTATGG - Intergenic
946465160 2:219905291-219905313 CTCTTCTTCTGGCAGGATTATGG - Intergenic
1176720055 21:10385330-10385352 ATCTTCTGGTGGGTGGACTATGG - Intergenic
1180075290 21:45458803-45458825 GTCTCGGGCTGGCAGGGCTAGGG - Intronic
953413406 3:42702446-42702468 ATCTGGGGCAGGCAGGACCAGGG - Intronic
957769617 3:84673999-84674021 ATCTGCTGTTGGCAGGAGTAAGG - Intergenic
966210771 3:177451010-177451032 TTCATCGGATGGCAGGATTATGG + Intergenic
966451611 3:180069747-180069769 ATCTTGGGATGGGAGGACCAGGG - Intergenic
968282153 3:197485111-197485133 ATCTGTGGCTGGCAGGACCCAGG - Intergenic
969997707 4:11331304-11331326 ATCTTTGGGTGATAGGACTAAGG + Intergenic
971461649 4:26905174-26905196 ATGTTTGGCTGGCAGCATTAAGG + Intronic
976298068 4:83491858-83491880 ATCTTTGGATGGAAGGATTATGG - Intronic
979552626 4:122008317-122008339 ATCTTTGGATGGCAAGACTTTGG + Intergenic
979945677 4:126829047-126829069 AGCTCCGGGTGGCAGAACTAGGG + Intergenic
982514238 4:156324253-156324275 ATCTTGGGCTGGCAGCATGATGG - Intergenic
998498285 5:142610029-142610051 ATCTTCTGCTTCCAGGATTAAGG - Intronic
999733008 5:154490132-154490154 ATATTAGGGTGGCAGGATTATGG + Intergenic
1002815816 6:678787-678809 ATCTTTGGCTGTCCTGACTACGG - Intronic
1005012813 6:21351846-21351868 ATCTTTGGCTGGTAGAACTAAGG - Intergenic
1007006772 6:38371416-38371438 ATCACTGGCTGGGAGGACTAGGG + Intronic
1007007731 6:38382345-38382367 ATCTGAGGCTGGCAGAACAAAGG - Intronic
1010740642 6:79499632-79499654 ATCTTCGGCTGGCAGGACTATGG + Intronic
1011131653 6:84058238-84058260 ATCATCAGCTGCCTGGACTATGG - Intronic
1013288008 6:108697510-108697532 ATTTTCTCCTGGCAGCACTAAGG + Intergenic
1013349416 6:109291859-109291881 ATCATCTGCTGGCAGGAATTTGG + Intergenic
1017292220 6:152752128-152752150 ATCTTTGGCTGGAAGAACTGAGG + Intronic
1017585023 6:155910800-155910822 CTCTTTGGATGGCAGGATTAAGG - Intergenic
1022015624 7:26346249-26346271 CTCTCCTGCTGGCAGGACCAAGG - Intronic
1022493566 7:30838853-30838875 ATCTTCCACAGGCAAGACTAGGG - Intronic
1027489324 7:78803291-78803313 ATCTTGGGCTGGCATAATTACGG + Intronic
1033032438 7:137840350-137840372 ACCTCCGGCTGGCTGGACAATGG + Intronic
1038696671 8:29812516-29812538 ATCTCCGGCTGGCAGTACCATGG + Intergenic
1042826072 8:72980839-72980861 ATCTGCGGCTGGTAGGCCTGGGG - Intergenic
1050335118 9:4583118-4583140 ATCCTCGGCGGGCAGGCCCACGG - Exonic
1055011147 9:71566815-71566837 ATCTTAAGCTAGCAGAACTATGG - Intergenic
1059691213 9:116687511-116687533 ATCTGGGGGGGGCAGGACTAGGG + Intronic
1188447156 X:30266983-30267005 ATCTTTGGGTGGTAGGATTATGG - Intergenic