ID: 1010749639

View in Genome Browser
Species Human (GRCh38)
Location 6:79603791-79603813
Sequence AAGAAAAAAGAAAAGTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010749639_1010749641 14 Left 1010749639 6:79603791-79603813 CCAGACCACTTTTCTTTTTTCTT No data
Right 1010749641 6:79603828-79603850 AGAATCTTGCTCTGTTACCCAGG 0: 45
1: 1661
2: 22969
3: 81601
4: 153888
1010749639_1010749642 18 Left 1010749639 6:79603791-79603813 CCAGACCACTTTTCTTTTTTCTT No data
Right 1010749642 6:79603832-79603854 TCTTGCTCTGTTACCCAGGCTGG 0: 1374
1: 50320
2: 125765
3: 203521
4: 198053
1010749639_1010749643 28 Left 1010749639 6:79603791-79603813 CCAGACCACTTTTCTTTTTTCTT No data
Right 1010749643 6:79603842-79603864 TTACCCAGGCTGGAGTACAGTGG 0: 402
1: 17338
2: 182501
3: 291302
4: 204542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010749639 Original CRISPR AAGAAAAAAGAAAAGTGGTC TGG (reversed) Intergenic
No off target data available for this crispr