ID: 1010749700

View in Genome Browser
Species Human (GRCh38)
Location 6:79604217-79604239
Sequence CTCAAAATCCACATGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010749695_1010749700 16 Left 1010749695 6:79604178-79604200 CCTTCACTCAGTTCTTCTTTGTA No data
Right 1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG No data
1010749694_1010749700 20 Left 1010749694 6:79604174-79604196 CCAGCCTTCACTCAGTTCTTCTT No data
Right 1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010749700 Original CRISPR CTCAAAATCCACATGGACAA AGG Intergenic
No off target data available for this crispr