ID: 1010751610

View in Genome Browser
Species Human (GRCh38)
Location 6:79621746-79621768
Sequence GTGTATATCAAGAAGGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010751610_1010751612 1 Left 1010751610 6:79621746-79621768 CCATTCTCCTTCTTGATATACAC No data
Right 1010751612 6:79621770-79621792 TTCTAAGCCTCCTTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010751610 Original CRISPR GTGTATATCAAGAAGGAGAA TGG (reversed) Intergenic
No off target data available for this crispr