ID: 1010759289

View in Genome Browser
Species Human (GRCh38)
Location 6:79703859-79703881
Sequence TATACCTTGAATAGAATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 1, 2: 5, 3: 37, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010759289 Original CRISPR TATACCTTGAATAGAATTGC TGG Intergenic
902156335 1:14489923-14489945 TTTCCCTAGAATAGACTTGCTGG + Intergenic
903410342 1:23137833-23137855 AATTCCTAGAGTAGAATTGCTGG - Intronic
904233037 1:29093062-29093084 TATACCCGTAATAGGATTGCTGG + Intronic
904432812 1:30476104-30476126 CAAACCTAGAATAGACTTGCAGG + Intergenic
904670882 1:32164387-32164409 TATACCCAGAGTGGAATTGCTGG + Intronic
905602334 1:39264241-39264263 GATACCTGGACTGGAATTGCTGG + Intronic
906499565 1:46331708-46331730 TTTAACTTGACTTGAATTGCTGG - Intergenic
907794658 1:57703667-57703689 TATACCAGTAATAGGATTGCTGG - Intronic
908942840 1:69456353-69456375 TATACTTTGTTTGGAATTGCAGG + Intergenic
912165967 1:107042675-107042697 TATGCTTTGGAAAGAATTGCTGG - Intergenic
912190724 1:107337092-107337114 TATACCCAGAATGGAATTCCTGG - Intronic
913549301 1:119901800-119901822 TATACCTAGAGTGGAATTGCTGG - Intergenic
913586977 1:120285075-120285097 TATACCCAGAGTAGAATTGCTGG - Intergenic
913621208 1:120613295-120613317 TATACCCAGAGTAGAATTGCTGG + Intergenic
914568991 1:148896960-148896982 TATACCCAGAGTAGAATTGCTGG - Intronic
914603836 1:149233296-149233318 TATACCCAGAGTAGAATTGCTGG + Intergenic
915922694 1:159988752-159988774 TATTCATTGAATGGAATAGCAGG + Intergenic
917125298 1:171682323-171682345 TATACCCAGAGTGGAATTGCAGG + Intergenic
917529051 1:175816655-175816677 TGTACATTGAATAAAATTGTTGG + Intergenic
919862147 1:201747091-201747113 TAAATCTTGAAGAGAATTGATGG + Intronic
920739558 1:208567652-208567674 TATACCCTGAAGGAAATTGCAGG + Intergenic
921107739 1:211999788-211999810 TTTTCCTTGATTAGACTTGCCGG - Intronic
924657947 1:245990466-245990488 TCGACCTTGAATAAAATTTCTGG + Intronic
1064705857 10:18071608-18071630 TATTCCTGGAATGGAATTCCTGG + Intergenic
1066551783 10:36566721-36566743 AATCCCTTAAATAGCATTGCTGG - Intergenic
1067844179 10:49706217-49706239 TATACTAGGAATAGAATTGCTGG - Intronic
1068901676 10:62276830-62276852 TATAACTTTTATAGCATTGCTGG - Intergenic
1069399212 10:68024397-68024419 TATACCCAGAATGGAATTACTGG - Intronic
1070065620 10:73030994-73031016 TATACCTAGAAGTAAATTGCTGG - Intronic
1072643372 10:97231816-97231838 TATACCGGGAGTAGCATTGCTGG + Intronic
1073665472 10:105527791-105527813 TATACCTGGAAGTGGATTGCTGG - Intergenic
1074873023 10:117592236-117592258 TATACCCAGAAGTGAATTGCTGG - Intergenic
1074919797 10:117995664-117995686 AATTCCTAGAATAAAATTGCTGG + Intergenic
1075197918 10:120377327-120377349 TATACCTAGAGAAGAAATGCTGG + Intergenic
1075272633 10:121065842-121065864 TGTACCTGGCATAAAATTGCTGG + Intergenic
1076536020 10:131178202-131178224 TTTGCCTTTACTAGAATTGCAGG + Intronic
1078137949 11:8667923-8667945 TATATCCAGAATGGAATTGCTGG + Intronic
1078861520 11:15251862-15251884 TATACCATGAGTGGAATTGCTGG - Intergenic
1079590056 11:22172076-22172098 TATAGCTTGAACTGAATTACAGG - Intergenic
1083030538 11:59587801-59587823 TATACCAGAAATGGAATTGCTGG - Intronic
1084230861 11:67751642-67751664 CATACCTTGATTAGAATGGAAGG - Intergenic
1084746895 11:71176568-71176590 AATACCCTGAATAGAATTAATGG + Intronic
1086754946 11:90548856-90548878 TATACTTTTTATAGCATTGCTGG - Intergenic
1086881184 11:92155504-92155526 TGTGCATTGAATAGAATTGAAGG - Intergenic
1086910182 11:92463215-92463237 TGTTCCTTGACTATAATTGCTGG + Intronic
1088359063 11:108972320-108972342 TTTCCCTTGAGTGGAATTGCTGG + Intergenic
1089150937 11:116363703-116363725 TATATCTTGAATAGAATACTAGG - Intergenic
1090216752 11:124973825-124973847 TATCCCTTGAAGAGAAATGATGG - Intronic
1092956605 12:13556793-13556815 CATGCTTTGAATATAATTGCTGG - Exonic
1093604085 12:21068545-21068567 TATACCTAGTATGGGATTGCTGG + Intronic
1097489772 12:60251721-60251743 TATACCTTTACTAGAGTTTCTGG - Intergenic
1097617763 12:61903970-61903992 TAGATCTTGAAAAGAATAGCAGG - Intronic
1098303141 12:69074877-69074899 TATCCCTTTAATAAAATTTCAGG - Intergenic
1100771623 12:97929253-97929275 TATACCCAGCATGGAATTGCTGG + Intergenic
1102649919 12:114433337-114433359 TTTATTTTGAGTAGAATTGCTGG - Intergenic
1103730507 12:123024403-123024425 TTTACCTAGAGTGGAATTGCTGG - Intronic
1106212514 13:27663359-27663381 TTTACCTAGAATAGAATCCCAGG + Intronic
1107070737 13:36266038-36266060 TAAACTTTGACTAGTATTGCAGG + Intronic
1107332423 13:39315986-39316008 TATACCCAAAATAGAATTGCTGG + Intergenic
1107761141 13:43680407-43680429 TATACTTTGAATTGAACTGAAGG - Intronic
1107823805 13:44309546-44309568 TATACCTTGAATACAGTACCTGG + Intergenic
1108906491 13:55481222-55481244 TATACCTAGTATTGGATTGCTGG + Intergenic
1111379190 13:87424220-87424242 TATACCTGTAATGGGATTGCTGG + Intergenic
1111519822 13:89385925-89385947 TTTACCTTGAAGAGATTTGGAGG - Intergenic
1113498174 13:110750320-110750342 TGTACATTGAATGCAATTGCAGG - Intergenic
1113883737 13:113646315-113646337 TATACGCTGAGCAGAATTGCCGG - Intergenic
1116906621 14:50409961-50409983 TATACCTGAAGTAGGATTGCTGG + Intronic
1118529893 14:66692008-66692030 TATATTTTGCATAGAATTTCAGG - Intronic
1118745948 14:68773252-68773274 GATGCCTTGAATAGAATGGCTGG + Intergenic
1119244902 14:73095758-73095780 CTCACCTTGAATAGAGTTGCAGG + Intronic
1119942686 14:78657774-78657796 TATACGTTTATTTGAATTGCTGG + Intronic
1121224747 14:92313074-92313096 AAGACCTTGAATATAATTTCTGG - Intergenic
1121762773 14:96460049-96460071 TTTCCCTTGGATAGAATTTCAGG + Intronic
1125729984 15:41887685-41887707 TAGAACATGAATAGAATTGAGGG + Intronic
1127409794 15:58694571-58694593 TTTTTCTTGAGTAGAATTGCTGG - Intronic
1127429836 15:58893728-58893750 TATATCTGGATTAGAATTTCAGG + Intronic
1127510232 15:59633552-59633574 TTTCTCTTGAATAGAATTTCAGG + Intronic
1128473531 15:67976674-67976696 TGTACCAGGAGTAGAATTGCTGG + Intergenic
1130394110 15:83487132-83487154 TATACCCTGAGTGGAATTGCTGG + Intronic
1131273789 15:90963575-90963597 TATACCCAGAGTGGAATTGCTGG + Intergenic
1132171112 15:99656505-99656527 AATTACTTGAATAGAAATGCTGG + Intronic
1134753405 16:16645170-16645192 TATACCCAGCATGGAATTGCTGG + Intergenic
1134992653 16:18713911-18713933 TATACCCAGCATGGAATTGCTGG - Intergenic
1136751612 16:32641354-32641376 TATACCCAGAATTAAATTGCTGG + Intergenic
1136855597 16:33654314-33654336 TATACCCAGAATTGGATTGCTGG - Intergenic
1137066139 16:35845953-35845975 TATACCTAGAGTGGAATTGCTGG - Intergenic
1137981029 16:53069747-53069769 TATACCTATAATGGAATTGCTGG + Intronic
1138367812 16:56496784-56496806 TAAACCAGGAATAGAATTGCTGG + Intronic
1139157877 16:64466144-64466166 TATACCTTGCGAAGAATTTCTGG - Intergenic
1139235988 16:65339827-65339849 TATAATCTGAATAGAGTTGCTGG + Intergenic
1140555232 16:75914196-75914218 TATACCTGCAATAAAATTGCTGG - Intergenic
1140762995 16:78128606-78128628 TATAACATCAACAGAATTGCTGG + Intronic
1203053747 16_KI270728v1_random:900609-900631 TATACCCAGAATTAAATTGCTGG + Intergenic
1203117183 16_KI270728v1_random:1502795-1502817 TATACCCAGAATTGGATTGCTGG - Intergenic
1146600190 17:34207514-34207536 GATACCTAGGGTAGAATTGCAGG + Intergenic
1149884064 17:60323126-60323148 TATACCTTGCATGGAATTTCTGG - Intronic
1150159100 17:62879370-62879392 TATATCTAGAGCAGAATTGCTGG - Intergenic
1157554595 18:48605135-48605157 TATACCTGGAGTGGAATTGTTGG + Intronic
1157563770 18:48665965-48665987 TATACCTGGGGTGGAATTGCTGG + Intronic
1159313878 18:66745487-66745509 TCTACCTCAAATAGAAATGCTGG + Intergenic
927299433 2:21494290-21494312 TATGCTTAGAATAGAATTGCAGG + Intergenic
928470081 2:31567202-31567224 TTTCCCTTGAGTAGAATTCCTGG + Intronic
929799917 2:45090971-45090993 TATACCAGTAATAGGATTGCTGG + Intergenic
930849375 2:55942195-55942217 TATTCCTGGATTAGAATTGCTGG + Intergenic
931037162 2:58256776-58256798 TATACCTAGAATGTAACTGCTGG + Intergenic
932911547 2:75811197-75811219 TATACCTGGGGTAGGATTGCTGG + Intergenic
936342669 2:111650077-111650099 TATACCTAGGATTGAATTGCTGG - Intergenic
938321121 2:130364873-130364895 TACACCTAGCATGGAATTGCTGG + Intronic
938376278 2:130808786-130808808 TATACCCAGAGTAGGATTGCTGG - Intergenic
938657595 2:133450285-133450307 TATACCCAGAGAAGAATTGCTGG - Intronic
939099475 2:137879897-137879919 TTTTCCTTGAAGAGAATTGTGGG + Intergenic
939324249 2:140667475-140667497 TACACCTTGGATAGTATTGTTGG + Intronic
939650222 2:144751805-144751827 AATACCATGAAAGGAATTGCTGG - Intergenic
939853176 2:147324109-147324131 TATACCAGAAAAAGAATTGCTGG - Intergenic
940357016 2:152754574-152754596 TATACCTAGAGTGGAATTGTTGG + Intronic
941239921 2:163024645-163024667 TATACCCAGAATGGGATTGCTGG - Intergenic
941240884 2:163036227-163036249 TATACTCAGAATAGGATTGCTGG + Intergenic
941653176 2:168115665-168115687 TATATCTTAAATGAAATTGCAGG + Intronic
941931311 2:170942717-170942739 TATACCTGGAGTGGAATTGCTGG + Intronic
942165913 2:173240747-173240769 TATACCTAGAGTGGGATTGCTGG - Intronic
944151371 2:196562119-196562141 GATACGCTGAATAGATTTGCAGG + Intronic
944268751 2:197758130-197758152 TATAACTAGAGTGGAATTGCTGG - Intronic
944660595 2:201918485-201918507 TATACCTAGAGTGGAACTGCTGG + Intergenic
944822837 2:203448524-203448546 TATACTTGGAATAATATTGCTGG - Intronic
945186711 2:207146911-207146933 TATATGTTGCATAGAATAGCAGG - Intronic
945684672 2:212954581-212954603 AATACCTAGAGTAGGATTGCTGG - Intergenic
946060984 2:216941386-216941408 TAAACATTAGATAGAATTGCAGG + Intergenic
946573815 2:221052632-221052654 TACACCTTGAATAGAATAATAGG - Intergenic
948968218 2:241401490-241401512 TATACATTGTATAGAAATGGAGG + Intronic
1169290422 20:4345177-4345199 TATACTTGGAGTAAAATTGCTGG + Intergenic
1170930271 20:20763340-20763362 TATACCTGGAATGGAATTTCTGG - Intergenic
1177065663 21:16431151-16431173 AATACCTAGAATACAATTACAGG - Intergenic
1177114096 21:17064773-17064795 TATACATTTAATAGATGTGCAGG - Intergenic
1177548850 21:22595138-22595160 AATGCCTTGAAAAGAATTGCTGG + Intergenic
1181884012 22:26004700-26004722 TATCCCTAGAATAAGATTGCAGG - Exonic
1181902252 22:26166212-26166234 TATAAGGTGAATAGAATTGTAGG + Intergenic
1182854305 22:33503447-33503469 TGTACCTAGAACGGAATTGCTGG - Intronic
949228235 3:1719443-1719465 TTTACCCAGAATGGAATTGCTGG + Intergenic
949300473 3:2577648-2577670 TATTAGTTGAATAGAATTCCAGG - Intronic
949429126 3:3953968-3953990 AATACCTGGAAGAGGATTGCTGG + Intronic
949992416 3:9590660-9590682 TATGCCAGGAGTAGAATTGCTGG - Intergenic
950245312 3:11410919-11410941 TATAGCCAGAATTGAATTGCTGG + Intronic
950245316 3:11410955-11410977 TATATCCAGAATTGAATTGCTGG + Intronic
951466913 3:23010869-23010891 TATACCTGGAGCAAAATTGCTGG - Intergenic
952742811 3:36750515-36750537 TATACGATGATTAGACTTGCTGG + Intergenic
952908006 3:38156083-38156105 TATACCAGGAGTGGAATTGCTGG + Intergenic
953604086 3:44397639-44397661 AATACCTAGAATAGAATGGCTGG + Intronic
953695647 3:45156381-45156403 TATACCCAGAGTAGAATTGCTGG + Intergenic
955019675 3:55107169-55107191 TATGCCTTGAATATACTTTCAGG + Intergenic
955108607 3:55925254-55925276 TATACCTTGCATTCAATGGCAGG + Intronic
956331141 3:68110490-68110512 TATACCCAGTATAGGATTGCTGG + Intronic
956383223 3:68687616-68687638 TATACCTGGAGTAGAATTGCTGG + Intergenic
957646315 3:82934171-82934193 TATTCCTGGAATGGAATTACTGG + Intergenic
958584167 3:96064646-96064668 TTTACCTGGAGTAGAATTGCTGG - Intergenic
960996018 3:123340797-123340819 TATATCTAGAATGGCATTGCTGG - Intronic
961135531 3:124506522-124506544 TATACATTAACTAGAATTTCAGG + Intronic
962037022 3:131662943-131662965 TATACCTGTAACAGGATTGCTGG - Intronic
962308125 3:134306921-134306943 TTTACCTTGAATGGCAGTGCTGG + Intergenic
962818761 3:139026220-139026242 TTTACCCTGAATGGAATTGGAGG - Intronic
963109690 3:141677297-141677319 TATACCTAGAGTGGAACTGCTGG - Intergenic
963172983 3:142270138-142270160 TATACCTAGGATGAAATTGCTGG - Intergenic
964095011 3:152921179-152921201 TATACCTAGAGTAGAATTCTTGG + Intergenic
964736077 3:159919315-159919337 TATACCTAAAATAAAATTACTGG - Intergenic
964788135 3:160422214-160422236 TATACCTAGGGTAGAACTGCTGG + Intronic
965914183 3:173820948-173820970 TCTATCTTGAATTGAATTACAGG + Intronic
966069081 3:175852872-175852894 TATATCTGGAATAAATTTGCAGG + Intergenic
968200409 3:196749257-196749279 CATACCCAGAATGGAATTGCTGG + Intronic
969160001 4:5248557-5248579 TATGCCATGAATATTATTGCTGG + Intronic
969356129 4:6627227-6627249 CATACCTAGAACAGAATTGCTGG - Intergenic
969500211 4:7548112-7548134 TTTTCCTTGGTTAGAATTGCTGG + Intronic
969823639 4:9739763-9739785 AATACCTTGATTAGAATGGAAGG + Intergenic
970064018 4:12070501-12070523 TCTTCCTTTAATTGAATTGCTGG - Intergenic
970822509 4:20234896-20234918 TATATCTAGAAAAGAAGTGCAGG + Intergenic
971652844 4:29301834-29301856 AATTCCTTAAATAGATTTGCTGG - Intergenic
972547673 4:40096125-40096147 CATACCTGGAATAGAACTACAGG - Intronic
972938035 4:44163654-44163676 TACACCTAGAGTGGAATTGCTGG - Intergenic
973537410 4:51897246-51897268 TAAACATTTAATATAATTGCAGG + Intronic
973612755 4:52652366-52652388 TAAACCTGGAAGGGAATTGCTGG - Intronic
973711954 4:53638966-53638988 TATATCTGTAATGGAATTGCTGG - Intronic
976735547 4:88305134-88305156 TATACCTGGAGTAGAATTGTTGG - Intergenic
977530052 4:98190380-98190402 TATACTAGGAATAAAATTGCCGG + Intergenic
978508538 4:109488610-109488632 TTTCTCTTGAGTAGAATTGCTGG + Intronic
978673370 4:111278790-111278812 TATACTTGGAGTGGAATTGCTGG - Intergenic
979012047 4:115384491-115384513 TATACCAGTAATAGGATTGCTGG + Intergenic
980537608 4:134149154-134149176 TAACCTTTGAGTAGAATTGCTGG + Intergenic
981261270 4:142721933-142721955 TATACCTTCAATGGAAATCCTGG + Intronic
981443063 4:144805273-144805295 TATACCTCCAGTTGAATTGCTGG - Intergenic
981863726 4:149388194-149388216 GATATCTGGAATGGAATTGCTGG + Intergenic
983824725 4:172244712-172244734 TATCCATTGAATAGATTTGATGG - Intronic
984031175 4:174605930-174605952 GATAACTTGAATAGAATGGGAGG - Intergenic
984725032 4:183012673-183012695 TATACCTTGAAGTGAATTCGTGG + Intergenic
986982674 5:13467265-13467287 TATACCAAGAATGGGATTGCTGG + Intergenic
988054240 5:26072715-26072737 AATACCTTAAATAATATTGCTGG - Intergenic
988518651 5:31926699-31926721 TATACCTAGTATAGAATTGCTGG - Intronic
990092267 5:52066766-52066788 TATACCAAAAATAGAATTGTGGG + Intronic
990521150 5:56582528-56582550 TATACCCAGTATAGGATTGCTGG + Intronic
991046257 5:62225852-62225874 TATACCCAGAATTGGATTGCTGG + Intergenic
991771000 5:70041015-70041037 TATGCCAGGAATGGAATTGCTGG + Intronic
991850294 5:70916432-70916454 TATGCCAGGAATGGAATTGCTGG + Intronic
992983911 5:82207167-82207189 TATATCAAGAATAGAATTGCTGG + Intronic
993260521 5:85652509-85652531 CATACCTTGAATCTAATTTCTGG - Intergenic
993684571 5:90922451-90922473 TATACTTTGAACACATTTGCCGG + Intronic
995484904 5:112630217-112630239 AATACCTTCAATATAGTTGCTGG - Intergenic
996192186 5:120558657-120558679 TATACCTAGAGTGGGATTGCTGG + Intronic
996570620 5:124929349-124929371 TAACCCTTGAATAGCAGTGCTGG + Intergenic
996652932 5:125903407-125903429 TAACTCTTGAATAGAATTGGAGG - Intergenic
998163907 5:139829844-139829866 TATACCTAGGATTGACTTGCTGG + Intronic
998272008 5:140714968-140714990 TATACCAGAAATGGAATTGCTGG + Intergenic
998746655 5:145267668-145267690 TATACCTAGCAGAGGATTGCTGG + Intergenic
999590741 5:153143037-153143059 TCTACCATGACTAGGATTGCAGG - Intergenic
1000179785 5:158797288-158797310 CATACTTTCAACAGAATTGCTGG + Intronic
1001993961 5:176140141-176140163 TATACCCAGAATTAAATTGCTGG + Intergenic
1002910538 6:1487866-1487888 TATATCTGGAGAAGAATTGCTGG - Intergenic
1003035358 6:2636768-2636790 TATACCCGGAAGAGGATTGCTGG + Intergenic
1004676866 6:17851239-17851261 TATACCTTGATTTAAATGGCTGG + Intronic
1004983498 6:21053479-21053501 GACACCTAGAGTAGAATTGCTGG + Intronic
1005171992 6:22997868-22997890 TAAACTTTGCAGAGAATTGCTGG - Intergenic
1009045579 6:58233672-58233694 ACTACCTTGAATAGAAGTGGTGG + Intergenic
1009221397 6:60987988-60988010 ACTACCTTGAATAGAAGTGGTGG + Intergenic
1009539675 6:64937763-64937785 TAAAACTAGAGTAGAATTGCTGG - Intronic
1010759289 6:79703859-79703881 TATACCTTGAATAGAATTGCTGG + Intergenic
1011919911 6:92560709-92560731 TATACTTAGTGTAGAATTGCTGG + Intergenic
1012310379 6:97716851-97716873 TTTCCCTGGAATAGAATTCCAGG - Intergenic
1012529450 6:100216647-100216669 TATATCTTTAACAAAATTGCAGG + Intergenic
1012637271 6:101559795-101559817 TATGCTTTGAATACAACTGCTGG + Intronic
1013427209 6:110023623-110023645 TTTACCTTGAATAGTCTTCCTGG + Intergenic
1013457389 6:110343059-110343081 TATACCTGGAATGCAATTGCTGG + Intronic
1013848833 6:114488821-114488843 TGCACTTTGAATAGAATTACTGG - Intergenic
1017495053 6:154976388-154976410 TGTAACTGGAGTAGAATTGCTGG - Intronic
1018302437 6:162417987-162418009 TATACCTAGAGTAGAATTGCCGG - Intronic
1020217570 7:6206091-6206113 TATAACTAGAGTGGAATTGCTGG - Intronic
1020234156 7:6342587-6342609 TATACTTAGAGCAGAATTGCTGG - Intronic
1020624908 7:10566356-10566378 TATTCCTAGAGTGGAATTGCTGG - Intergenic
1020741944 7:12031239-12031261 TATACCTTGAACAGAATTGCTGG + Intergenic
1020870161 7:13619459-13619481 TATACATTGGATAGAATTAAAGG - Intergenic
1022060272 7:26786134-26786156 AATAGTTTGTATAGAATTGCCGG - Intronic
1023238812 7:38120083-38120105 TATACCCAGAATGGGATTGCTGG - Intergenic
1024132272 7:46365672-46365694 TATATTTTGAATATAAGTGCTGG + Intergenic
1024212972 7:47222635-47222657 TATACCTAGAGTGGAATTGCTGG + Intergenic
1026681567 7:72471189-72471211 TGTTCCTTTAATAGAAATGCTGG - Intergenic
1027462279 7:78469651-78469673 ACTACCTTGAATAGTAGTGCAGG + Intronic
1027802932 7:82778396-82778418 TATACCAGTAATAGGATTGCTGG - Intronic
1029097364 7:98098907-98098929 TATACCAGGAATAGAACTGCTGG + Intergenic
1030559799 7:111070389-111070411 TATACCATTAATAGAATTCGTGG - Intronic
1030645814 7:112060450-112060472 TATACCCAGAATAGAATTGCTGG - Intronic
1031203047 7:118715975-118715997 TATACCTAGAATGGAATTTTGGG + Intergenic
1031297891 7:120027007-120027029 TATACCCAGTATAGGATTGCTGG + Intergenic
1031372155 7:120981583-120981605 GATACCCTGTATAGGATTGCTGG + Intergenic
1033383346 7:140846139-140846161 TATACCAGGAGTAGAATTGCAGG - Intronic
1035846095 8:2866444-2866466 TATACTTTCAATAGAAATACTGG + Intergenic
1036959562 8:13229060-13229082 TATACCTAGAAGTGGATTGCTGG - Intronic
1038262413 8:26007871-26007893 TATAACTTGAAAAGTATAGCAGG + Intronic
1039173602 8:34778917-34778939 TATACCCAGTATGGAATTGCTGG - Intergenic
1039690047 8:39853145-39853167 TATACTTGGAGTGGAATTGCTGG + Intergenic
1040722877 8:50347850-50347872 TATACTTTAAATAGAGTTGTGGG + Intronic
1041416502 8:57615858-57615880 TATACCTAGCAGAGAATTGCTGG - Intergenic
1041705208 8:60839439-60839461 TATACCAGGAGTGGAATTGCTGG + Intronic
1041744620 8:61194205-61194227 TTTACATTTAATAGAATTACTGG - Intronic
1044346811 8:91114281-91114303 TATACCCAGAGTAGGATTGCTGG - Intronic
1045194518 8:99916727-99916749 TATACCCAGAGTAGGATTGCTGG + Intergenic
1045335645 8:101201959-101201981 TATACCAAGAGTGGAATTGCTGG - Intronic
1045420442 8:102009395-102009417 TCTACCCTGAATAAAATGGCAGG - Intronic
1045549907 8:103162381-103162403 TATTTGTTGAATAAAATTGCTGG + Intronic
1046262281 8:111784420-111784442 TTTTCCATTAATAGAATTGCTGG + Intergenic
1046881391 8:119312393-119312415 TATACCCATAATAGAATTGCTGG - Intergenic
1046988851 8:120425937-120425959 TATACATTGAATAGTACTGGAGG + Intronic
1047425057 8:124737671-124737693 TATACCTATAGTGGAATTGCTGG + Intergenic
1047531166 8:125677444-125677466 TATACCTAGAATTAAATTGCTGG - Intergenic
1047782461 8:128121090-128121112 TTTACCTTAAATAGAAGAGCAGG + Intergenic
1047803744 8:128336986-128337008 TATACTTAGAAATGAATTGCTGG + Intergenic
1047810854 8:128407433-128407455 CATACTTTGTATAGAATTGCAGG + Intergenic
1050256889 9:3802961-3802983 TATAAAATGAGTAGAATTGCTGG + Intergenic
1051693246 9:19740208-19740230 CATACCATGAATGGAATTGCTGG - Intronic
1052114613 9:24635122-24635144 TATACCCAGAATGGGATTGCTGG + Intergenic
1054892922 9:70271453-70271475 TATTCCTTGAGTAGAATGGTGGG + Intronic
1056101829 9:83307302-83307324 TATACCTAGGATGGAACTGCTGG - Intronic
1056246285 9:84698552-84698574 AATACCTGGAATAGAATTGCTGG + Intronic
1056557409 9:87701326-87701348 AATACCTTGAATAGAAATTGTGG + Intronic
1059209142 9:112495550-112495572 TACACTTTGAATAGCAGTGCAGG - Intronic
1060221605 9:121766904-121766926 TATACCTTGAGTAGAAGGACAGG - Intronic
1060541364 9:124432685-124432707 TTTACTTTGGAGAGAATTGCAGG - Intergenic
1060884940 9:127144484-127144506 TATACCCTGAGTACAATTGCTGG - Intronic
1062611712 9:137378158-137378180 ACTGCCTGGAATAGAATTGCTGG - Intronic
1187413083 X:19068100-19068122 TATACCTAGGAGGGAATTGCTGG - Intronic
1187858757 X:23662009-23662031 TATACCTAGAGTGGAATTGTTGG - Intergenic
1188512298 X:30949520-30949542 AATACCTGGAATGGAATTACTGG + Intronic
1188667378 X:32840910-32840932 TATGTCTACAATAGAATTGCTGG + Intronic
1189449419 X:41114189-41114211 TAAACCTTGAATAACATTACGGG + Intronic
1195920959 X:109983277-109983299 TATACTCAGAGTAGAATTGCTGG - Intergenic
1196851925 X:119946101-119946123 TATAAAATGAATAGAAATGCTGG - Intergenic
1201973825 Y:19825706-19825728 TATACCTGCAATGGGATTGCTGG - Intergenic
1201982781 Y:19925436-19925458 AATAGCTTGAATACAATAGCAGG + Intergenic