ID: 1010759462

View in Genome Browser
Species Human (GRCh38)
Location 6:79706430-79706452
Sequence ACTGTTCTGCAGATTGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010759462_1010759464 -6 Left 1010759462 6:79706430-79706452 CCATCTACAATCTGCAGAACAGT No data
Right 1010759464 6:79706447-79706469 AACAGTGATGACTATTAATAGGG No data
1010759462_1010759463 -7 Left 1010759462 6:79706430-79706452 CCATCTACAATCTGCAGAACAGT No data
Right 1010759463 6:79706446-79706468 GAACAGTGATGACTATTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010759462 Original CRISPR ACTGTTCTGCAGATTGTAGA TGG (reversed) Intergenic
No off target data available for this crispr