ID: 1010760262

View in Genome Browser
Species Human (GRCh38)
Location 6:79714476-79714498
Sequence CACCTGGGGTTCCCTTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010760257_1010760262 3 Left 1010760257 6:79714450-79714472 CCTTTCTTGTCAGGTCTGAGAGC No data
Right 1010760262 6:79714476-79714498 CACCTGGGGTTCCCTTCACCTGG No data
1010760255_1010760262 23 Left 1010760255 6:79714430-79714452 CCATGGGTGTGTGAAAGGTACCT No data
Right 1010760262 6:79714476-79714498 CACCTGGGGTTCCCTTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010760262 Original CRISPR CACCTGGGGTTCCCTTCACC TGG Intergenic
No off target data available for this crispr