ID: 1010768196

View in Genome Browser
Species Human (GRCh38)
Location 6:79799884-79799906
Sequence CTGTATTTGAATGAGTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010768190_1010768196 12 Left 1010768190 6:79799849-79799871 CCTTTTATTTTCTTTTTATTTTC No data
Right 1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010768196 Original CRISPR CTGTATTTGAATGAGTAGGA TGG Intergenic
No off target data available for this crispr