ID: 1010768246

View in Genome Browser
Species Human (GRCh38)
Location 6:79800276-79800298
Sequence GGGCCTTAATCAATAACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010768242_1010768246 22 Left 1010768242 6:79800231-79800253 CCTGGTCGAAACAGTCTTTATGC No data
Right 1010768246 6:79800276-79800298 GGGCCTTAATCAATAACCCCAGG No data
1010768241_1010768246 30 Left 1010768241 6:79800223-79800245 CCACTGCACCTGGTCGAAACAGT No data
Right 1010768246 6:79800276-79800298 GGGCCTTAATCAATAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010768246 Original CRISPR GGGCCTTAATCAATAACCCC AGG Intergenic
No off target data available for this crispr