ID: 1010768364

View in Genome Browser
Species Human (GRCh38)
Location 6:79801543-79801565
Sequence AGTCATGTGCTGCAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010768360_1010768364 27 Left 1010768360 6:79801493-79801515 CCAAAGTGGAAGGTACTTATTTG No data
Right 1010768364 6:79801543-79801565 AGTCATGTGCTGCAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010768364 Original CRISPR AGTCATGTGCTGCAGATGGC AGG Intergenic
No off target data available for this crispr