ID: 1010768462

View in Genome Browser
Species Human (GRCh38)
Location 6:79802421-79802443
Sequence TAGAAGCCTGAGATCTGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010768462_1010768465 14 Left 1010768462 6:79802421-79802443 CCACTCCAGATCTCAGGCTTCTA No data
Right 1010768465 6:79802458-79802480 GAGATCAAAGCTGCTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010768462 Original CRISPR TAGAAGCCTGAGATCTGGAG TGG (reversed) Intergenic
No off target data available for this crispr