ID: 1010774595

View in Genome Browser
Species Human (GRCh38)
Location 6:79870469-79870491
Sequence TAGTGTCTACAGCAGTGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010774592_1010774595 26 Left 1010774592 6:79870420-79870442 CCTGAGATTGCTTTACAAAACAC No data
Right 1010774595 6:79870469-79870491 TAGTGTCTACAGCAGTGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010774595 Original CRISPR TAGTGTCTACAGCAGTGGCA TGG Intergenic
No off target data available for this crispr