ID: 1010775968

View in Genome Browser
Species Human (GRCh38)
Location 6:79886200-79886222
Sequence GCTTTGGTTGCCTGTGATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4282
Summary {0: 6, 1: 368, 2: 737, 3: 1111, 4: 2060}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010775968_1010775973 -6 Left 1010775968 6:79886200-79886222 CCACAATCACAGGCAACCAAAGC 0: 6
1: 368
2: 737
3: 1111
4: 2060
Right 1010775973 6:79886217-79886239 CAAAGCAAATATGGGCAAATGGG No data
1010775968_1010775972 -7 Left 1010775968 6:79886200-79886222 CCACAATCACAGGCAACCAAAGC 0: 6
1: 368
2: 737
3: 1111
4: 2060
Right 1010775972 6:79886216-79886238 CCAAAGCAAATATGGGCAAATGG No data
1010775968_1010775974 30 Left 1010775968 6:79886200-79886222 CCACAATCACAGGCAACCAAAGC 0: 6
1: 368
2: 737
3: 1111
4: 2060
Right 1010775974 6:79886253-79886275 AAAAAGCTTCTGCACAGCAAAGG 0: 881
1: 2123
2: 2216
3: 1798
4: 1589

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010775968 Original CRISPR GCTTTGGTTGCCTGTGATTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr