ID: 1010775972

View in Genome Browser
Species Human (GRCh38)
Location 6:79886216-79886238
Sequence CCAAAGCAAATATGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010775967_1010775972 -6 Left 1010775967 6:79886199-79886221 CCCACAATCACAGGCAACCAAAG 0: 6
1: 405
2: 716
3: 884
4: 1064
Right 1010775972 6:79886216-79886238 CCAAAGCAAATATGGGCAAATGG No data
1010775968_1010775972 -7 Left 1010775968 6:79886200-79886222 CCACAATCACAGGCAACCAAAGC 0: 6
1: 368
2: 737
3: 1111
4: 2060
Right 1010775972 6:79886216-79886238 CCAAAGCAAATATGGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010775972 Original CRISPR CCAAAGCAAATATGGGCAAA TGG Intergenic
No off target data available for this crispr