ID: 1010776807

View in Genome Browser
Species Human (GRCh38)
Location 6:79896211-79896233
Sequence ACAGTGGCAGAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010776807_1010776811 -6 Left 1010776807 6:79896211-79896233 CCCTGCTCCATCTCTGCCACTGT No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010776807 Original CRISPR ACAGTGGCAGAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr