ID: 1010776811

View in Genome Browser
Species Human (GRCh38)
Location 6:79896228-79896250
Sequence CACTGTTTAACCGTCTGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010776806_1010776811 0 Left 1010776806 6:79896205-79896227 CCTATGCCCTGCTCCATCTCTGC No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data
1010776800_1010776811 27 Left 1010776800 6:79896178-79896200 CCGTGGCCTTGGCCTGGGCTCGG No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data
1010776804_1010776811 21 Left 1010776804 6:79896184-79896206 CCTTGGCCTGGGCTCGGGAGGCC No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data
1010776807_1010776811 -6 Left 1010776807 6:79896211-79896233 CCCTGCTCCATCTCTGCCACTGT No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data
1010776808_1010776811 -7 Left 1010776808 6:79896212-79896234 CCTGCTCCATCTCTGCCACTGTT No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data
1010776805_1010776811 15 Left 1010776805 6:79896190-79896212 CCTGGGCTCGGGAGGCCTATGCC No data
Right 1010776811 6:79896228-79896250 CACTGTTTAACCGTCTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010776811 Original CRISPR CACTGTTTAACCGTCTGAGT AGG Intergenic
No off target data available for this crispr