ID: 1010778615

View in Genome Browser
Species Human (GRCh38)
Location 6:79916853-79916875
Sequence CCATGTGACCATTGGGCACA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010778615 Original CRISPR CCATGTGACCATTGGGCACA CGG (reversed) Exonic
900370765 1:2331165-2331187 CCAGGTGGACATGGGGCACATGG + Intronic
900733632 1:4280529-4280551 CCATGTTAACAATGGGCAAATGG + Intergenic
901334302 1:8435700-8435722 TCATTTTCCCATTGGGCACATGG - Intronic
902518988 1:17005210-17005232 CCATCTGAGCATTGGGCAGAAGG - Intronic
903323157 1:22554498-22554520 CCATGTGACAGATGAGCACATGG + Intergenic
906901560 1:49842167-49842189 GCATGTGACCTTTGAGGACATGG + Intronic
906975792 1:50571386-50571408 CTGTGTGACCATGGGGCAAATGG + Intronic
913091221 1:115478030-115478052 ACATGTGACCACTGAGCACTTGG - Intergenic
913274865 1:117127117-117127139 CCATGTAACAAGTGGGCTCATGG - Intergenic
915977046 1:160398345-160398367 CCCTTAGACCATAGGGCACATGG + Intergenic
922159981 1:223072442-223072464 CCATGTTACCTTTGGGCTGAAGG + Intergenic
923070829 1:230562913-230562935 CCAGGTGACCCCTGGGAACATGG - Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
1064246699 10:13673549-13673571 ACATGTGTGCATTGTGCACATGG - Intronic
1064600603 10:16988320-16988342 CCATCTGAACATTCTGCACATGG + Intronic
1070844956 10:79514116-79514138 CCATGAGAGCAATGGGGACATGG + Exonic
1070928846 10:80246193-80246215 CCATGAGAGCAATGGGGACATGG - Intergenic
1071331286 10:84563633-84563655 CCATGGGACCTTCAGGCACAGGG - Intergenic
1071974319 10:90939873-90939895 CCACGGGACCACTGGACACAGGG + Intergenic
1072636758 10:97183251-97183273 CCATGTGCCCCTTGAGGACAGGG + Intronic
1072683773 10:97524903-97524925 CCATGTGACTATGCTGCACATGG - Intronic
1083251180 11:61468320-61468342 CCATGCGATCATTGGAGACAGGG - Intronic
1087683991 11:101243026-101243048 GCATATGACCATGGGGCCCAGGG + Intergenic
1089325021 11:117651059-117651081 GCCTGTGACCATGGGGGACATGG + Intronic
1089765484 11:120760639-120760661 CAATGAGAACGTTGGGCACAGGG - Intronic
1089767327 11:120777414-120777436 CAATGTGACTATGGGGCACTGGG - Intronic
1090760241 11:129830682-129830704 TCATGTGCTTATTGGGCACATGG - Intronic
1091360382 11:134974691-134974713 CCATGTGACCTATGTGGACAGGG + Intergenic
1091484789 12:875235-875257 CCATGTTATCTTTGGGCATATGG - Intronic
1097675359 12:62596098-62596120 CCAGGTAACCATTGGGCCAAAGG + Exonic
1102978040 12:117220604-117220626 CCCGGTGACCATTGGCCACCAGG - Intronic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1108556183 13:51595192-51595214 CCAGGAGACCAGTGGGGACAAGG - Intronic
1112451446 13:99514762-99514784 ACATGTGGCTATTGGGCACTTGG - Intronic
1114031903 14:18585937-18585959 CCAGGTGAACATTGGGCTCCAGG - Intergenic
1114410671 14:22497472-22497494 CCATGAGACCATTGCTGACAAGG - Intergenic
1115545977 14:34465068-34465090 CCAGGGGACAATTGAGCACATGG + Intergenic
1117097055 14:52309692-52309714 CCAGGTTAGCATTGGCCACAAGG + Intergenic
1118401506 14:65383875-65383897 CCATGGGACCTTTGGGCCTAGGG - Intergenic
1120676012 14:87422288-87422310 CCAGATGACCATTGTGCACAAGG - Intergenic
1121882160 14:97510477-97510499 CCATCAGAGCATGGGGCACATGG + Intergenic
1129738073 15:77976699-77976721 CCAGGGGACCCTTGGGGACAGGG + Intergenic
1129848003 15:78776910-78776932 CCAGGGGACCCTTGGGGACAGGG - Intronic
1131971784 15:97900823-97900845 CCATGATAGAATTGGGCACAGGG - Intergenic
1136130993 16:28221267-28221289 CCATGTGACTTTTGGGTACAAGG - Intergenic
1137614721 16:49839386-49839408 CCATCTGACAGATGGGCACATGG - Intronic
1140244880 16:73239024-73239046 CCATTTGACCATGAGACACATGG + Intergenic
1143094371 17:4469416-4469438 CCATGTTTGCATTGGGCACCCGG - Intronic
1143552975 17:7642600-7642622 CCAAGTGAACATGGGGTACAAGG + Intergenic
1144950600 17:18991638-18991660 CCATGTGAGCAGCTGGCACAGGG + Intronic
1148685913 17:49501210-49501232 CCATGTGGCCACTGGGAACAGGG - Intronic
1149374468 17:56030503-56030525 CCATGGGAGCAATGAGCACAGGG - Intergenic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151871955 17:76842414-76842436 GAATGTGACCATTGGAGACAGGG + Intergenic
1152419379 17:80183899-80183921 CCATGAGACCTGTGGGCAGATGG - Exonic
1154494752 18:14947316-14947338 CCATGTGACCTATGTGGACAGGG - Intergenic
1155945299 18:31842334-31842356 CCAACTGACCAATGTGCACAGGG + Intronic
1156199916 18:34818975-34818997 CCATTTGAACAGTGAGCACATGG - Intronic
1156804787 18:41165020-41165042 TAATGTGACCACTGGGCTCAAGG + Intergenic
1157928765 18:51795834-51795856 ACATGGGTCCACTGGGCACAGGG + Intergenic
1160827807 19:1088859-1088881 CTGTGTGACCGCTGGGCACAAGG - Intronic
1163204015 19:15789071-15789093 GAATGTGACCTTTGGACACAGGG - Intergenic
1164429682 19:28176253-28176275 CCTTGTGACCACTGGCTACATGG - Intergenic
1164429683 19:28176253-28176275 CCATGTAGCCAGTGGTCACAAGG + Intergenic
929243736 2:39679174-39679196 CCAGGTTAGTATTGGGCACATGG + Intronic
933733580 2:85477080-85477102 AGATGTGGCCATGGGGCACAAGG - Intergenic
934990254 2:98915425-98915447 CCATGGGACCATAGGGACCAGGG + Intronic
935559079 2:104542680-104542702 CCATGTCATGATTGGGCACCTGG + Intergenic
935682064 2:105646869-105646891 CCATTTGACCATTGTACACCTGG - Intergenic
938776364 2:134544844-134544866 CCATGTGGTCATTGGGTACTTGG - Intronic
939966641 2:148616818-148616840 CCATGTGACCATTAGGCAACAGG - Intergenic
942241933 2:173970921-173970943 ACATGTGACCATTAGGAACTTGG + Intergenic
944274611 2:197821700-197821722 CCATATGACCACTGGGCCAATGG - Intronic
944436427 2:199695366-199695388 CCATGTGGCTATTGGGCACTTGG + Intergenic
944461788 2:199956981-199957003 CCAAGTGACCATATGTCACAAGG - Intronic
945028387 2:205641462-205641484 CCAACTGACCCTTGGGCTCAGGG - Intergenic
945681230 2:212916641-212916663 CCATGTGACAATTTTGCCCAAGG + Intergenic
947789374 2:232855028-232855050 ACATGTGACCATTGGGCATTCGG + Intronic
1171459148 20:25288766-25288788 CTTTGTGCCCAGTGGGCACAGGG + Intronic
1172846842 20:37934698-37934720 CCATGTGGAGAATGGGCACAGGG + Intronic
1172885630 20:38229025-38229047 CCATCTGGCCAGTGGGTACAGGG + Intronic
1173276846 20:41592134-41592156 ACCTGTGACCATTGGACTCACGG - Intronic
1173590281 20:44219728-44219750 CCCTGTGAGCAGTGGCCACAGGG - Intergenic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1180456017 22:15512994-15513016 CCAGGTGAACATTGGGCTCCAGG - Intergenic
1182047264 22:27285014-27285036 GCATGGGACCCATGGGCACAAGG - Intergenic
1183423645 22:37726042-37726064 CCCTGTGTGCATTGGGCACCGGG + Exonic
1184177512 22:42797213-42797235 CCATGTGACACATGGGCTCAGGG - Exonic
958771362 3:98429183-98429205 CCATGTCACCCTGGGGCCCAAGG + Intergenic
966009732 3:175059972-175059994 CCAGGTAATCATTGAGCACATGG + Intronic
966434692 3:179870149-179870171 CTATGTGACTATTAGCCACAAGG - Intronic
967158769 3:186717357-186717379 CCATTTAACCTTTGGGAACAAGG + Exonic
969212535 4:5698898-5698920 CCATGTGAACAGTAGCCACATGG - Intronic
970146534 4:13042059-13042081 CAAAGAGACCAGTGGGCACATGG + Intergenic
970373811 4:15435896-15435918 CGATGCGACCATGGGGCCCAGGG - Exonic
975704392 4:77097652-77097674 CCATGTGAACATATGGCAAAAGG + Intergenic
976839444 4:89414124-89414146 CCTTGTGACCATTAGGAATAGGG - Intergenic
977471179 4:97445639-97445661 ACATGTGACTATTTGGCACTTGG - Intronic
981239064 4:142452628-142452650 CCAGCTGACCAGTGGCCACACGG + Intronic
982800630 4:159702325-159702347 CCATTTGACCTCTGAGCACAGGG - Intergenic
983520268 4:168701272-168701294 CCTTCTGAGCACTGGGCACATGG - Intronic
987346880 5:16986726-16986748 CCATGTCACTATTTGGCACCAGG - Intergenic
994123271 5:96141800-96141822 CCCTACGACCAATGGGCACATGG + Intergenic
994123270 5:96141800-96141822 CCATGTGCCCATTGGTCGTAGGG - Intergenic
999369925 5:151048548-151048570 ACAGGTGACCCTGGGGCACAAGG + Intronic
1000269047 5:159665683-159665705 CCCTGTGCCCATTAGGCAGATGG - Intergenic
1000269048 5:159665683-159665705 CCATCTGCCTAATGGGCACAGGG + Intergenic
1006742082 6:36316177-36316199 TCTTGTGACCCTTGGGGACATGG - Exonic
1007336289 6:41157328-41157350 CCATGTGAGCTATGGCCACAGGG + Intergenic
1009422582 6:63480169-63480191 CCAGGTAACCATTGTGCACCTGG - Intergenic
1009696810 6:67116814-67116836 CAATGAGAACATTGGACACAGGG - Intergenic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1010778616 6:79916853-79916875 CCGTGTGCCCAATGGTCACATGG + Exonic
1012171168 6:96017624-96017646 CCATGGAACCCTTGGTCACAGGG + Intronic
1015658548 6:135546902-135546924 CCCTGTGACCAATGGGCGGAGGG + Intergenic
1017423943 6:154301357-154301379 TCATGAGACTCTTGGGCACAAGG + Intronic
1017741993 6:157414650-157414672 CCAGGCCACCACTGGGCACAGGG + Intronic
1018807190 6:167270675-167270697 CCATGAGGACATTGGTCACATGG - Intergenic
1018807191 6:167270675-167270697 CCATGTGACCAATGTCCTCATGG + Intergenic
1024297585 7:47857793-47857815 CCATGTTAGCACTGGGCAGATGG - Exonic
1024399108 7:48903630-48903652 CCAGCTGACCATTAGCCACAAGG + Intergenic
1030973478 7:116090914-116090936 CAATGAGAACATAGGGCACAGGG + Intronic
1031836811 7:126689289-126689311 TCAAGTTACCATTGTGCACAGGG - Intronic
1032809568 7:135397884-135397906 GCCTGGGACCATTTGGCACAGGG + Intronic
1034726448 7:153340588-153340610 CCATGTGACCTCTGCACACAGGG - Intergenic
1036848676 8:12186681-12186703 ACAGGTGACCTTGGGGCACAGGG - Exonic
1036870037 8:12428962-12428984 ACAGGTGACCTTGGGGCACAGGG - Exonic
1037730576 8:21520246-21520268 CCATGCCAACATTGGGCACAGGG - Intergenic
1038148450 8:24919635-24919657 CGATGTGTCCAGTGGGGACAGGG + Intergenic
1043356407 8:79417661-79417683 CCATGTGGCCATTGGTAACATGG - Intergenic
1043356408 8:79417661-79417683 CCATGTTACCAATGGCCACATGG + Intergenic
1048418292 8:134251064-134251086 CAGTGTGTCCATTGGGCACAAGG + Intergenic
1051795573 9:20865569-20865591 CCATGTGGCCATACGGCACATGG - Intronic
1052897860 9:33764879-33764901 TCATGTGCTTATTGGGCACATGG - Intronic
1055003647 9:71481941-71481963 CCAGGAGACCCTTGGGGACATGG + Intergenic
1056576601 9:87859677-87859699 CCAGGTGTCCACTGGGCACCTGG + Intergenic
1057080441 9:92170990-92171012 CCATGTGACATTTCTGCACAGGG - Intergenic
1059693922 9:116713005-116713027 CCATGTGTCCAAAGGTCACATGG - Intronic
1059693923 9:116713005-116713027 CCATGTGACCTTTGGACACATGG + Intronic
1062345451 9:136112428-136112450 CCATGGGACCACTGAGTACAGGG - Intergenic
1190290864 X:48991217-48991239 GCATGTGGTCATTTGGCACAGGG - Intronic
1191593056 X:62910529-62910551 CCATGTAACTATTTTGCACATGG - Intergenic
1193764550 X:85510629-85510651 GCATGTGACCCTTTGGCACCAGG - Intergenic
1195559186 X:106263869-106263891 CCAGGAGAGCAATGGGCACAAGG + Intergenic
1197337559 X:125226388-125226410 TCTTGTGACCTTTGGCCACATGG + Intergenic
1198308294 X:135404245-135404267 CCATAAGACCATTGGGCAAGAGG - Intergenic