ID: 1010780298

View in Genome Browser
Species Human (GRCh38)
Location 6:79938017-79938039
Sequence ACATCACCTGCACTTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010780298_1010780304 29 Left 1010780298 6:79938017-79938039 CCATGCCCAAGTGCAGGTGATGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1010780304 6:79938069-79938091 TTCATAAAAGCCAGTTCATAAGG 0: 1
1: 0
2: 3
3: 27
4: 299
1010780298_1010780305 30 Left 1010780298 6:79938017-79938039 CCATGCCCAAGTGCAGGTGATGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1010780305 6:79938070-79938092 TCATAAAAGCCAGTTCATAAGGG 0: 1
1: 0
2: 3
3: 26
4: 292
1010780298_1010780302 2 Left 1010780298 6:79938017-79938039 CCATGCCCAAGTGCAGGTGATGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1010780302 6:79938042-79938064 AAATTCATGACTTCAGAAAATGG 0: 1
1: 0
2: 2
3: 48
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010780298 Original CRISPR ACATCACCTGCACTTGGGCA TGG (reversed) Intronic
900405729 1:2492166-2492188 ACAGCACCCTCACTTGGCCAGGG - Intronic
904991163 1:34593787-34593809 AGATCAACTGCACTTCGGCCTGG + Intergenic
905805250 1:40872127-40872149 ATATCAGCTCCACATGGGCAGGG - Intergenic
906287040 1:44594327-44594349 CCTTCACCTGCACTTGGGACTGG + Intronic
906912702 1:49972202-49972224 AAAAAACCTGCACTTGGGCCGGG - Intronic
910365698 1:86462744-86462766 ACACCACCTGCACTCTAGCATGG - Intergenic
920875424 1:209829955-209829977 ATTACACATGCACTTGGGCAGGG - Intronic
921612746 1:217231562-217231584 ACATCATCTTCAGCTGGGCATGG - Intergenic
922569318 1:226624538-226624560 ACAGCACCTGGGCTTGGGCAGGG - Intergenic
923803482 1:237233136-237233158 ACACCACCTTCACTTAGGCAGGG + Intronic
924573716 1:245260399-245260421 AAGTGACCTGCACTTGGGCCAGG - Intronic
924704232 1:246486357-246486379 ATATCACCTATACTTGGGTATGG - Intronic
1070922256 10:80195361-80195383 AAAACACCTTCACTTGGGAATGG + Intronic
1072675142 10:97460112-97460134 ACATGATCCGCACTTCGGCATGG + Exonic
1078018656 11:7637155-7637177 ACATCACCTTCTCATGTGCATGG + Intronic
1079430750 11:20386928-20386950 ATAATAACTGCACTTGGGCAGGG - Intergenic
1081809582 11:45907349-45907371 TCAGCACCTGCCCTGGGGCAGGG + Intergenic
1083602692 11:63958705-63958727 ACCTCTGCTGCACTTGGGGAGGG - Intergenic
1089459921 11:118646609-118646631 ACAGCTCCTTCACTTGGGCACGG + Intronic
1090838318 11:130469424-130469446 ACCTCACCTGAGCTGGGGCAGGG - Exonic
1091192147 11:133705021-133705043 AAATCATGTGCATTTGGGCATGG - Intergenic
1091397645 12:163478-163500 ACAGCACCTGCACGCGGGCAGGG - Exonic
1093098716 12:15001798-15001820 ACATCACCTCCACAAGGACAGGG + Intergenic
1094401961 12:30071321-30071343 TCTTCTCCTGCACTTGGACAGGG - Intergenic
1096203367 12:49702385-49702407 ACATCAGCTGCATTTGGTAAAGG + Intronic
1096542470 12:52315694-52315716 ACATCACCTATTCTAGGGCAGGG - Intronic
1097022091 12:56027677-56027699 AGAGCACCTTCCCTTGGGCAAGG + Intronic
1098425128 12:70354827-70354849 CCATCACATTCACTTGGGTATGG - Exonic
1102061102 12:109931671-109931693 ACATCACCGGCCCTAGGCCAGGG + Exonic
1103155957 12:118685083-118685105 ACATCAGCTGCCCTCTGGCATGG - Intergenic
1107033979 13:35881477-35881499 ACATCATCTGCATTTTGGCAGGG - Intronic
1110457165 13:75702283-75702305 ACTTCACCTTCTCTTGGGGAAGG - Intronic
1111255360 13:85660810-85660832 ACATCTCCCTTACTTGGGCATGG + Intergenic
1111832292 13:93344267-93344289 ACATTTCCTGCAAGTGGGCAGGG + Intronic
1113965171 13:114148799-114148821 ACGTCAGCTGCACCTGGACATGG + Intergenic
1115498092 14:34026831-34026853 AAATCACTTTCAGTTGGGCATGG + Intronic
1117392166 14:55271969-55271991 AGCTCACCTGCGCTGGGGCAGGG - Intronic
1117960221 14:61155001-61155023 ACATCACCTGCACTTCCTCATGG + Intergenic
1119326816 14:73764758-73764780 ACTTCACCTGTTCTGGGGCAGGG + Intronic
1123930630 15:25170136-25170158 ACATAGCCTGCCCCTGGGCATGG - Intergenic
1123938545 15:25205665-25205687 ACATAGCCTGCGCCTGGGCATGG - Intergenic
1124200704 15:27676736-27676758 ACATCACCTGGAACTTGGCAAGG - Intergenic
1125574208 15:40744308-40744330 ACATTAACTGCACGTGGGAAGGG - Intronic
1126250969 15:46567087-46567109 AAGTCAGCTGCACTTGGACAAGG - Intergenic
1126435932 15:48637517-48637539 ACATTGACTGCAGTTGGGCAGGG - Intronic
1126453445 15:48835247-48835269 AAAACTCCTGCACCTGGGCAAGG - Intronic
1127300428 15:57647724-57647746 ACACCTCCTGCACTTGGCCCTGG + Intronic
1128808881 15:70555615-70555637 ACATGGCATGCCCTTGGGCAAGG + Intergenic
1130067744 15:80618783-80618805 ACATCAGCTTAACTTTGGCAGGG - Intergenic
1130381925 15:83379035-83379057 ACACCACCTGCACCTGGGAGTGG + Intergenic
1132470190 16:98210-98232 TGATCACCCGCACTAGGGCAGGG + Exonic
1134193168 16:12138051-12138073 ACATCCCCTTCCCATGGGCATGG - Intronic
1134542864 16:15082710-15082732 ACATCAGTCGCACTTGGTCATGG + Intronic
1135360452 16:21808843-21808865 ACATCAGTCGCACTTGGTCATGG + Intergenic
1136262369 16:29088184-29088206 ACATCAGTCGCACTTGGTCATGG - Intergenic
1138026912 16:53529068-53529090 TCAGCACCTGCACTTGAGCGTGG - Intergenic
1138655787 16:58490494-58490516 ACACCACCTGCAGTAGGGCCAGG - Intronic
1139446902 16:67003647-67003669 ACATCAGCTCCACTAGGGAAGGG - Intronic
1140395493 16:74622836-74622858 ACATCAGCTTCACATGGGGAAGG + Exonic
1140404658 16:74700701-74700723 ACTGCAGCTGCACTTGAGCAGGG + Exonic
1142418000 16:89953631-89953653 AGATCCCCTGCTCCTGGGCATGG + Intronic
1143949897 17:10624094-10624116 CCATCACCTGTTCCTGGGCATGG + Intergenic
1147378090 17:40034942-40034964 ACATCCCAGGGACTTGGGCAGGG - Intronic
1148977019 17:51538615-51538637 ACAGCACCTACAATAGGGCAGGG - Intergenic
1149960243 17:61101117-61101139 ACATCACCTCCACTCTGGAATGG + Intronic
1150651522 17:67013268-67013290 ACAGCAGATGCACTTGGACATGG - Intronic
1150657535 17:67050063-67050085 CCATCCCCTGCCCTTGGGCTGGG + Intronic
1152868286 17:82736965-82736987 GCATCACCTGCTCTTATGCATGG - Intronic
1157559769 18:48638024-48638046 CCACCTCCTGCAGTTGGGCAAGG - Intronic
1162001621 19:7747822-7747844 ACACCCCCTCCACTAGGGCAAGG + Intergenic
1162100369 19:8335268-8335290 GCACCAGCTGCAGTTGGGCAGGG + Exonic
1165844786 19:38811232-38811254 ACATCAGCTCCACGAGGGCAGGG + Intronic
1168298263 19:55388469-55388491 ACATCACCTCCAGATGGACAAGG - Intronic
925764271 2:7215601-7215623 ACATCACCTGTACATGGGGCAGG + Intergenic
928489864 2:31770849-31770871 CCATCACTTGCACTCTGGCAAGG + Intergenic
928648607 2:33381844-33381866 CCCTCACCTGACCTTGGGCAAGG + Intronic
928918629 2:36502112-36502134 ACCTCACCTACACTTGCGCCTGG + Intronic
932777167 2:74535326-74535348 ACATCACCTGCAAGAGGACAGGG - Exonic
937972204 2:127559518-127559540 ACAGCTCTTGCACTTGGGCTAGG + Intronic
938135607 2:128754080-128754102 ACCTCACCTGCACAGGAGCAGGG - Intergenic
938240809 2:129741214-129741236 ACATCACCCACACTGGGCCACGG + Intergenic
940002411 2:148979560-148979582 ACTGCACCTGGCCTTGGGCAAGG + Intronic
940936773 2:159504370-159504392 ATATCCACTGCACTTGGGCCTGG - Intronic
941069777 2:160942900-160942922 AGCTCACATGTACTTGGGCACGG + Intergenic
944541246 2:200755784-200755806 ACCTCACCTGCACGTGGGCTGGG - Intergenic
947166619 2:227268577-227268599 GGATGACATGCACTTGGGCAGGG + Intronic
948483965 2:238268279-238268301 ACATCACCTGCAGCATGGCATGG - Intronic
1169332129 20:4724461-4724483 AAATCTCCTGCACTTGGGAGGGG + Intronic
1169522042 20:6384645-6384667 ACTTCACCTCCACTTGAGCTGGG - Intergenic
1172695258 20:36817985-36818007 ATAGCACCTGCCCTTGGACAAGG - Intronic
1172752419 20:37259925-37259947 CCATCACCTGCACGTGGGAAAGG + Intronic
1176070130 20:63222004-63222026 ACGTCATGTGCTCTTGGGCAAGG + Intergenic
1178453047 21:32722095-32722117 AAATCACTTGAACTTGGGAAGGG + Intronic
1178471629 21:32898742-32898764 ACATCATCAGCAGTTGGGCAGGG + Intergenic
1181853965 22:25769258-25769280 CCATCACCTGCTCTTGAGCAGGG - Exonic
1182281993 22:29223179-29223201 ACATCAGCCCCACTAGGGCAGGG - Intronic
1183688805 22:39376690-39376712 ACATCAGATGCACATGGGCCAGG + Intronic
1184367947 22:44064330-44064352 ACATTGCCTCCACCTGGGCACGG - Intronic
955429210 3:58824949-58824971 ACATAACCTGAACGGGGGCATGG - Intronic
955513932 3:59708082-59708104 ACATCACCTGCTCCTGTGAACGG - Intergenic
956362909 3:68468079-68468101 AAATCACATGCACTTTGACAGGG + Intronic
957486579 3:80870415-80870437 ACACCAGCTGCAGTTGGGGAGGG + Intergenic
961321688 3:126081678-126081700 ACCTCACCACCACTAGGGCAAGG + Intronic
961468918 3:127099243-127099265 ACATCATCTGCAATGGGGAATGG - Intergenic
961780644 3:129318295-129318317 ATATCACCTGCTCTGGGTCATGG - Intergenic
962403910 3:135083921-135083943 TCATCACCTGCTCCTGGGAAGGG - Intronic
964281341 3:155069853-155069875 ACATCACATGGACAAGGGCAAGG - Intronic
964504165 3:157380276-157380298 ACATCCTCTGCACTGGGGCCAGG + Intronic
966793684 3:183695192-183695214 ACATCACTTGCAGCTGGGCGCGG - Intergenic
969253015 4:5982385-5982407 ACATCATGAGCACATGGGCAGGG + Intronic
970196856 4:13559699-13559721 ACTTCACCTGCATTTGTGTAAGG - Intergenic
970461714 4:16281024-16281046 ACACCACCTCCCCTTGGCCAAGG + Intergenic
971813367 4:31456562-31456584 AGAACACCTGCAGATGGGCACGG + Intergenic
971851192 4:31988068-31988090 GCATAACCTGCAATTGGGTAAGG - Intergenic
973701192 4:53538960-53538982 AGATCTCCTGGACTTGGCCATGG - Intronic
976083000 4:81376681-81376703 ACCTCAACTGGACTTGGGCAGGG - Intergenic
977427798 4:96891220-96891242 ACATCATATGCATATGGGCATGG + Intergenic
979229547 4:118331643-118331665 ACAGCACCTGCCTTTGGGTATGG + Intronic
979725287 4:123953805-123953827 ACATCACTTGCAGTGTGGCAGGG - Intergenic
986216887 5:5727696-5727718 ACATAACATCCACTTGGGCTGGG + Intergenic
987982141 5:25099930-25099952 ACATCACCAGCACATGAGAACGG + Intergenic
990044268 5:51409838-51409860 ACATCACCTACACATAGGCCAGG + Intergenic
993239173 5:85358370-85358392 AAATTACCTCCACCTGGGCATGG - Intergenic
995319009 5:110810028-110810050 ACATCCAATGGACTTGGGCAGGG + Intergenic
997796955 5:136820025-136820047 TCACCACCTGCAGTAGGGCATGG - Intergenic
998885171 5:146686625-146686647 ACATCACCTTCATTTTGGGAAGG + Intronic
999971632 5:156869526-156869548 ACATAACCTGCTCTAGGGCCGGG + Intergenic
1002085059 5:176769477-176769499 ACATCAGCTGCACAAGGGCAGGG - Intergenic
1003447996 6:6202400-6202422 ACATCTCCAGCACTAGAGCAGGG + Intronic
1008707512 6:54181288-54181310 ACACCACCAGCACATGGGCTGGG + Intronic
1009358595 6:62785917-62785939 AAATCACCTGGCATTGGGCAAGG - Intergenic
1010780298 6:79938017-79938039 ACATCACCTGCACTTGGGCATGG - Intronic
1013862012 6:114647119-114647141 AAATCACCTGCACTGGGGCAAGG - Intergenic
1014619515 6:123648238-123648260 TCAACACATGAACTTGGGCAAGG + Intergenic
1014796588 6:125731888-125731910 AGATCACCTGCACGTGTGCATGG - Intergenic
1017068193 6:150549343-150549365 ACATCACCGGCACCTGTGAACGG - Intergenic
1018904153 6:168065347-168065369 ACCTCTCCTGCACTGGGGCTTGG - Intronic
1019812667 7:3175874-3175896 ATTTCCCCTGCACTTGGGGAAGG - Intergenic
1024509321 7:50190695-50190717 ACAGCACCTGCCTCTGGGCATGG + Intergenic
1025992049 7:66503990-66504012 CCAGCACTTGCACTTGGGCCAGG - Intergenic
1034228791 7:149502631-149502653 ACCTCACCTCCACTGGCGCAAGG - Intergenic
1035724369 8:1815383-1815405 CCAGCACCTGCACCTGGGGAGGG + Intergenic
1035727980 8:1836372-1836394 ATCTCACCTGCACCAGGGCAGGG + Intronic
1056410643 9:86323089-86323111 ACAACACCTACACTGGGTCAGGG - Exonic
1057233650 9:93341312-93341334 TGCTCAGCTGCACTTGGGCATGG - Intronic
1057252193 9:93512679-93512701 TGCTCAGCTGCACTTGGGCATGG + Intronic
1057397898 9:94696333-94696355 ACATAAGCTGCACAAGGGCAGGG + Intergenic
1062622456 9:137429001-137429023 TCCTCACCTGCACTTGGTCCAGG - Exonic
1203453510 Un_GL000219v1:143697-143719 ACATCCCCTGCACTCGGGCCTGG - Intergenic
1186961577 X:14742505-14742527 ACCTCACCTGCAATTGTACAAGG - Intergenic
1187127902 X:16470972-16470994 ACAGAACCTGCCCTTGGGCTGGG - Intergenic
1187268884 X:17762054-17762076 AAATTAGCTGCACATGGGCATGG - Intergenic
1187810073 X:23166168-23166190 ACATCACCAGAATTTGGACAAGG - Intergenic
1189240139 X:39518582-39518604 ACAGCCCCAGCACTCGGGCAAGG + Intergenic
1197630519 X:128852732-128852754 ATATACCCTGCAGTTGGGCAAGG - Intergenic
1199711491 X:150472900-150472922 AGAGGACCTGAACTTGGGCAAGG - Intronic