ID: 1010784030

View in Genome Browser
Species Human (GRCh38)
Location 6:79979030-79979052
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010784030_1010784033 -8 Left 1010784030 6:79979030-79979052 CCATCTTCCCTCATCTAGCACAG No data
Right 1010784033 6:79979045-79979067 TAGCACAGTCCTGAGAGACCTGG No data
1010784030_1010784041 30 Left 1010784030 6:79979030-79979052 CCATCTTCCCTCATCTAGCACAG No data
Right 1010784041 6:79979083-79979105 TCCTTTTCTAATGCGTTCCTGGG No data
1010784030_1010784040 29 Left 1010784030 6:79979030-79979052 CCATCTTCCCTCATCTAGCACAG No data
Right 1010784040 6:79979082-79979104 TTCCTTTTCTAATGCGTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010784030 Original CRISPR CTGTGCTAGATGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr