ID: 1010791995

View in Genome Browser
Species Human (GRCh38)
Location 6:80075498-80075520
Sequence CACGTTGCCCCCTGGGGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010791995_1010792000 -2 Left 1010791995 6:80075498-80075520 CCACTTCCCCAGGGGGCAACGTG No data
Right 1010792000 6:80075519-80075541 TGCTGTTTCAGATCAGGCCCAGG No data
1010791995_1010792001 1 Left 1010791995 6:80075498-80075520 CCACTTCCCCAGGGGGCAACGTG No data
Right 1010792001 6:80075522-80075544 TGTTTCAGATCAGGCCCAGGTGG No data
1010791995_1010791999 -8 Left 1010791995 6:80075498-80075520 CCACTTCCCCAGGGGGCAACGTG No data
Right 1010791999 6:80075513-80075535 GCAACGTGCTGTTTCAGATCAGG No data
1010791995_1010792003 15 Left 1010791995 6:80075498-80075520 CCACTTCCCCAGGGGGCAACGTG No data
Right 1010792003 6:80075536-80075558 CCCAGGTGGTGTGACTGTTTTGG No data
1010791995_1010792005 16 Left 1010791995 6:80075498-80075520 CCACTTCCCCAGGGGGCAACGTG No data
Right 1010792005 6:80075537-80075559 CCAGGTGGTGTGACTGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010791995 Original CRISPR CACGTTGCCCCCTGGGGAAG TGG (reversed) Intergenic
No off target data available for this crispr