ID: 1010792326

View in Genome Browser
Species Human (GRCh38)
Location 6:80078669-80078691
Sequence GAGGATTTGGTTTGAATCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010792326_1010792331 21 Left 1010792326 6:80078669-80078691 CCAAGGATTCAAACCAAATCCTC No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data
1010792326_1010792330 7 Left 1010792326 6:80078669-80078691 CCAAGGATTCAAACCAAATCCTC No data
Right 1010792330 6:80078699-80078721 TCACAATAATGTAAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010792326 Original CRISPR GAGGATTTGGTTTGAATCCT TGG (reversed) Intergenic
No off target data available for this crispr