ID: 1010792330

View in Genome Browser
Species Human (GRCh38)
Location 6:80078699-80078721
Sequence TCACAATAATGTAAGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010792326_1010792330 7 Left 1010792326 6:80078669-80078691 CCAAGGATTCAAACCAAATCCTC No data
Right 1010792330 6:80078699-80078721 TCACAATAATGTAAGCAACAAGG No data
1010792327_1010792330 -6 Left 1010792327 6:80078682-80078704 CCAAATCCTCTTTCTCCTCACAA No data
Right 1010792330 6:80078699-80078721 TCACAATAATGTAAGCAACAAGG No data
1010792325_1010792330 16 Left 1010792325 6:80078660-80078682 CCTGATACTCCAAGGATTCAAAC No data
Right 1010792330 6:80078699-80078721 TCACAATAATGTAAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010792330 Original CRISPR TCACAATAATGTAAGCAACA AGG Intergenic
No off target data available for this crispr