ID: 1010792331

View in Genome Browser
Species Human (GRCh38)
Location 6:80078713-80078735
Sequence GCAACAAGGCAAAATTAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010792325_1010792331 30 Left 1010792325 6:80078660-80078682 CCTGATACTCCAAGGATTCAAAC No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data
1010792329_1010792331 -7 Left 1010792329 6:80078697-80078719 CCTCACAATAATGTAAGCAACAA No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data
1010792326_1010792331 21 Left 1010792326 6:80078669-80078691 CCAAGGATTCAAACCAAATCCTC No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data
1010792328_1010792331 2 Left 1010792328 6:80078688-80078710 CCTCTTTCTCCTCACAATAATGT No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data
1010792327_1010792331 8 Left 1010792327 6:80078682-80078704 CCAAATCCTCTTTCTCCTCACAA No data
Right 1010792331 6:80078713-80078735 GCAACAAGGCAAAATTAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010792331 Original CRISPR GCAACAAGGCAAAATTAAAT AGG Intergenic
No off target data available for this crispr