ID: 1010799807

View in Genome Browser
Species Human (GRCh38)
Location 6:80162358-80162380
Sequence CTTACATTCTTTCAGAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010799807 Original CRISPR CTTACATTCTTTCAGAGTGC AGG (reversed) Intronic
903507071 1:23844543-23844565 CTCACAGCCTTCCAGAGTGCTGG - Intergenic
904205061 1:28848993-28849015 CTTGCCTTCTTGCAGAGTGGAGG - Intronic
904219466 1:28953573-28953595 CATACATTCATTCAGAGACCGGG - Intronic
904819325 1:33230832-33230854 TATATTTTCTTTCAGAGTGCTGG - Intergenic
908486742 1:64602013-64602035 ATTATATTCTTTCAGATTGTTGG + Intronic
910369920 1:86504354-86504376 CTTCCTTTCTTTCAGAGTAAGGG + Intergenic
910712157 1:90193274-90193296 ATTACCTTCTTTCAAAGAGCTGG - Intergenic
919759830 1:201090644-201090666 CCGAGATTCTTTCAGAGTGTCGG + Intronic
921697169 1:218224972-218224994 GTTACATTCTCAGAGAGTGCAGG + Intergenic
921947487 1:220896066-220896088 CTCACATTGTTTTAGAGGGCGGG + Intergenic
1063708621 10:8455473-8455495 CTTAAACTATTTCAGAGAGCTGG - Intergenic
1064720956 10:18228018-18228040 TTTACATTCTTTCAGGGTAGGGG + Intronic
1064891332 10:20177516-20177538 CCTACTTTCTCTCAAAGTGCTGG - Intronic
1066493979 10:35922955-35922977 CTGACTTTCTTTCAGAGTGTTGG - Intergenic
1069037646 10:63662035-63662057 CTTACATTCTTTCAAAGTTTGGG - Intergenic
1071068856 10:81668491-81668513 ATTGCATTTTTTCACAGTGCTGG - Intergenic
1071898599 10:90092904-90092926 CTTATATTCTTTCATTGTGTTGG - Intergenic
1074350320 10:112730435-112730457 TTTACATTCATTTAGAGTGAGGG + Intronic
1075983302 10:126760110-126760132 CTGAGATTCTTTCAGAGAGTCGG + Intergenic
1076274214 10:129182870-129182892 CGTACATTGTCTCAGAGTTCTGG + Intergenic
1076295787 10:129383314-129383336 CTCTCATTCTCTCAGAGTTCTGG + Intergenic
1076546658 10:131249971-131249993 CTTGCGTTCTTTCTGAATGCTGG - Intronic
1078006072 11:7533308-7533330 CAATCCTTCTTTCAGAGTGCTGG + Intronic
1079071053 11:17347774-17347796 TTTACATTTTTTGAGAGTACAGG + Intronic
1081893713 11:46566907-46566929 CTTACATTTTAGCAGAGTTCAGG - Intronic
1082969166 11:59000887-59000909 TTTTCATTATTTCAGAGTGCAGG + Intronic
1083407820 11:62470988-62471010 CTGACGTTCTTTCAGCTTGCAGG - Intronic
1084504065 11:69554174-69554196 CATACATTCATTCATAGTGTTGG - Intergenic
1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG + Intergenic
1085289756 11:75389380-75389402 CTTTCATTCTTACACAGAGCAGG - Intergenic
1086338513 11:85824054-85824076 TTTACATTTTGTCTGAGTGCGGG + Intergenic
1090661970 11:128889225-128889247 CTTACCTTCTTTCATCGAGCGGG - Intergenic
1090983412 11:131744658-131744680 CTAAAATTGTTTCAGAGTCCAGG - Intronic
1091176257 11:133561016-133561038 CTTGCAATCTTTCACAGGGCAGG + Intergenic
1092944765 12:13442547-13442569 CTGACATTGTTTCAGAGTACTGG + Intergenic
1094098058 12:26730270-26730292 CCTACTTTTTTTCAGTGTGCAGG + Intronic
1097074668 12:56383988-56384010 CCTACATCCTTTAAGAGTGAGGG - Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1098901720 12:76118233-76118255 CCTACATTTTGGCAGAGTGCAGG - Intergenic
1100398972 12:94211287-94211309 CTTATCTTCTTTGAGAGTGGTGG - Intronic
1101743889 12:107523106-107523128 CTTAAATTCTTTCATAGTTCAGG - Intronic
1103864312 12:124039604-124039626 TTTTCATTCTTTCGGAGTTCTGG - Intronic
1104505262 12:129325996-129326018 CTTCCATCCTTTCAGAGTCCCGG - Intronic
1105925648 13:25005259-25005281 CATAAATTCTTACACAGTGCAGG - Intergenic
1106039053 13:26072403-26072425 CATAGATTCTTACACAGTGCAGG + Intergenic
1107709073 13:43134736-43134758 CTTAAGTTCCTTCAGATTGCAGG - Intergenic
1109851645 13:68073458-68073480 GTTCAATTTTTTCAGAGTGCCGG - Intergenic
1111745425 13:92262465-92262487 CTAGCTTTCTTTCAGAGTGAAGG + Intronic
1112342627 13:98565329-98565351 CTTATATTCTATTAGAGGGCTGG + Intronic
1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG + Intergenic
1114678187 14:24459627-24459649 CTTACATACTCTGACAGTGCTGG + Intergenic
1115445920 14:33489547-33489569 TTTACATTCTTTTAAAGTGGAGG - Intronic
1117055674 14:51909957-51909979 ATTCCATTCTTTCAGAGTCCTGG - Intronic
1125431583 15:39600262-39600284 CTTATTTTCTTTCAGAGTTTGGG - Exonic
1127816317 15:62612232-62612254 CTTCCCTTTTGTCAGAGTGCTGG + Intronic
1128614761 15:69100521-69100543 CCTACATTCTTCCTGAGTGTAGG + Intergenic
1132267055 15:100483486-100483508 CTAAAATTCTTCCAGAGTTCAGG - Intronic
1134039645 16:11058732-11058754 GTTACAGTTTTTCAGAGTGGTGG + Intronic
1138373004 16:56542254-56542276 TTTACATTCTTAGAGAGAGCAGG - Intergenic
1141100981 16:81197374-81197396 CCTACCTCCTTTCAGAATGCCGG + Intergenic
1142048037 16:87938315-87938337 CTTACAATCTTTTAGGGGGCAGG + Intergenic
1142321080 16:89383408-89383430 CTCACATTCTCCCAGAGTGTGGG - Intronic
1144217789 17:13071838-13071860 CTTACATTAGGTCAAAGTGCAGG - Intergenic
1146106673 17:30044661-30044683 CTTAAATTCTCTTAGATTGCTGG + Intronic
1148678137 17:49456969-49456991 CTTACATGCTTACAGGGTGGAGG - Intronic
1149094120 17:52819989-52820011 CTTACTTCCTTTAAGAGTACTGG - Intergenic
1151482334 17:74377698-74377720 CTTTCTTTCTTTCTGAGTGGGGG + Intergenic
1151526457 17:74672314-74672336 CTTTGATTATTTCAGAGTGATGG - Intronic
1154135318 18:11772733-11772755 CTTCCATTCATGCAGGGTGCGGG + Intronic
1155199486 18:23504319-23504341 TTTAGATCCTTTCAGAGTTCAGG + Intronic
1158231163 18:55256992-55257014 CTTTCCTGCTATCAGAGTGCTGG - Intronic
1158648340 18:59266484-59266506 TTTACATTGTTTCTAAGTGCTGG - Intergenic
1159377924 18:67618178-67618200 TTTACATTCTTTCAGTCTGATGG - Intergenic
1160133547 18:76251430-76251452 TTGACATTCTTTAAGACTGCTGG + Intergenic
1161272505 19:3397774-3397796 CTCACATTCTTTCTGAGCACTGG - Intronic
1165256982 19:34583193-34583215 GTTACATTCTTTTAAAGTGTAGG + Intergenic
925534495 2:4901654-4901676 CTTTCATTCTTTCAGAATGTTGG - Intergenic
926655793 2:15404286-15404308 CTTTCATTCTTCCTGAATGCAGG - Intronic
929650610 2:43676817-43676839 TTTACATTCTTACAGACTGATGG - Intronic
934556636 2:95290012-95290034 CTTAGCTTCTCTCTGAGTGCTGG + Exonic
938980553 2:136522253-136522275 CTTGCATTGCTTCAGGGTGCAGG + Intergenic
941899153 2:170661237-170661259 CTCTCATTCTCTCAAAGTGCTGG + Intergenic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
942577261 2:177377297-177377319 CTACCATACTTTCAGAATGCAGG - Intronic
946863867 2:224025244-224025266 TTTTCATTCCCTCAGAGTGCAGG + Intronic
947885163 2:233563521-233563543 GTTATATTCTTTCTAAGTGCTGG + Intronic
1168767324 20:390517-390539 CTTTCATTCATTCAGTATGCTGG - Intronic
1170058689 20:12236383-12236405 TTTACATTCTTTCCGAGTGAAGG - Intergenic
1174496810 20:50951159-50951181 CTTACCTCTTTTCAGACTGCAGG + Intronic
1175321504 20:58091411-58091433 CTTACATTCTTGTTGAGGGCAGG - Intergenic
1175346207 20:58278308-58278330 CTTGCTTTCTTTAAGAGGGCAGG - Intergenic
1175709715 20:61209602-61209624 CTAACAATCATTCAGAGGGCAGG + Intergenic
1178471765 21:32899905-32899927 ATAACATTCTTGAAGAGTGCCGG - Intergenic
951167848 3:19503951-19503973 ATTACTTTCTTTAAGAATGCTGG + Intronic
951936858 3:28031911-28031933 CTTAGATACTTTCACAGTGTAGG + Intergenic
951937269 3:28035530-28035552 CTTACATACTTTCATAATGCAGG + Intergenic
952715994 3:36481718-36481740 CTAACAATCTTTTGGAGTGCAGG + Intronic
953643729 3:44733694-44733716 CTTACTTTCTTTCAGTAAGCAGG + Intronic
955083553 3:55679965-55679987 CTTTCATTCTTCCAGAGGGGAGG + Intronic
957425474 3:80033874-80033896 ATTACATTCTTTGAGAGTGCAGG + Intergenic
957536895 3:81517569-81517591 ATAAAATACTTTCAGAGTGCAGG + Intronic
959140076 3:102475150-102475172 CTTTCATTTTTTCAGAGTCCTGG + Intronic
959585114 3:108018590-108018612 CTTACTGTCTTTCAGTGTGATGG - Intergenic
959883663 3:111474501-111474523 CTGTCATTGTTTCATAGTGCTGG + Intronic
961999155 3:131276974-131276996 CTGACATTTTTGAAGAGTGCAGG + Intronic
962375154 3:134852961-134852983 CTTCCATACTGTCAGAGGGCAGG + Intronic
967767540 3:193297578-193297600 ATAACATTCTATCAGAGTGACGG - Intronic
968163367 3:196445053-196445075 CTTACATTTTAGCAGAGTTCAGG - Intergenic
971022769 4:22554934-22554956 CTGATAATGTTTCAGAGTGCAGG - Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
976052659 4:81027775-81027797 ATTAAATTGTTTCAGAATGCTGG - Intergenic
978461403 4:108957387-108957409 GTTACATTCTTTGACAGTGATGG - Intronic
981558467 4:146022215-146022237 CCTACATTCTTTCAAATAGCTGG - Intergenic
981691851 4:147517527-147517549 CATACATCCTTTCAGAATGAAGG + Intronic
983328411 4:166290340-166290362 CCAACATTCTCTCACAGTGCTGG + Intergenic
984898911 4:184566942-184566964 CTCTCAGTCTTCCAGAGTGCTGG + Intergenic
985951486 5:3224927-3224949 CTTCCAAACATTCAGAGTGCTGG - Intergenic
985976907 5:3426526-3426548 ATTTCACTCTTTCAAAGTGCTGG - Intergenic
987964245 5:24851457-24851479 CTTAAATTCTTTTACAGTTCTGG + Intergenic
988994134 5:36698159-36698181 CTTCCATTCTTTCCCAGTACAGG + Intergenic
989579614 5:43019531-43019553 CTTACATTCTCTCAGGATCCGGG + Intergenic
989956229 5:50363727-50363749 CTAAAATTTTTTCAGAGTTCTGG - Intergenic
990902543 5:60768641-60768663 CTGACATTCTTTCAGTCTGATGG + Intronic
994111987 5:96016786-96016808 GTGACATTCTCTCAGAGTGCTGG + Intergenic
995430939 5:112076121-112076143 CTTACATTCTTTGAGAAAACAGG - Intergenic
995458817 5:112380916-112380938 CTTACATTCCTTCTGGTTGCAGG + Intronic
996396662 5:123020835-123020857 TTTACATTCTTTCAGAAAGATGG + Intronic
998145185 5:139723680-139723702 TTTACCTTCTTCCAAAGTGCTGG + Intergenic
998910568 5:146955655-146955677 CTTGCTTACTCTCAGAGTGCAGG + Intronic
1000452965 5:161413015-161413037 CTCACATCCTCCCAGAGTGCTGG + Intronic
1001284778 5:170415165-170415187 GTTTCATTCTTTCTGAGTGAGGG + Intronic
1001600033 5:172922754-172922776 CTTCTATTCTCTCAGAGTCCAGG - Intronic
1002767577 6:255636-255658 CGTTCATTCATTCAGAATGCAGG - Intergenic
1002909742 6:1480649-1480671 CTTATATTTTTTCATAGTCCTGG + Intergenic
1006752973 6:36390895-36390917 CTTACATTCTTCTAGAAGGCAGG + Exonic
1008918411 6:56815977-56815999 CTTACTTTTTTTCAGAGTCAGGG - Intronic
1009819148 6:68777170-68777192 CTTACATGCTATTACAGTGCGGG - Intronic
1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG + Intronic
1010799807 6:80162358-80162380 CTTACATTCTTTCAGAGTGCAGG - Intronic
1011408992 6:87046165-87046187 CTTACATTTTTTCTAAGTACAGG + Intergenic
1012927448 6:105281980-105282002 CTTACATGCTTCCAGAGCCCTGG + Intronic
1013431001 6:110054786-110054808 CTCCCATTCTTTCAGAGAGGAGG + Intergenic
1013681130 6:112527575-112527597 CTTTTATTCTTTCAGGTTGCTGG - Intergenic
1014404991 6:121040164-121040186 GTTGCATTTTTACAGAGTGCTGG + Intergenic
1016794508 6:148103682-148103704 CTTTCATTCTTGCAGTGGGCGGG + Intergenic
1017175220 6:151496098-151496120 CTGACATTTTTGCAGAGTCCAGG + Intronic
1020283949 7:6665687-6665709 CAGACATTCTTTCAGACTCCAGG - Intergenic
1020626329 7:10584671-10584693 CTTACATTGTTTGAAAGTTCAGG - Intergenic
1021152247 7:17165933-17165955 CTTACAGGCTTTCAGAGAGCTGG + Intergenic
1022129768 7:27394407-27394429 CAATCATTCTGTCAGAGTGCAGG - Intergenic
1022599901 7:31747940-31747962 CTTACATTTTAGCAGAGTTCAGG + Intergenic
1023527200 7:41117211-41117233 GTTTCATTTTTTCAGATTGCAGG + Intergenic
1024118341 7:46213458-46213480 TTTGAATTATTTCAGAGTGCTGG + Intergenic
1024426288 7:49230096-49230118 CTAAAATTCTTTTAGAGTGAGGG + Intergenic
1027977345 7:85175687-85175709 CTTACACTCTTTCATCATGCAGG + Intronic
1031439408 7:121774692-121774714 TTTACTATCTTGCAGAGTGCTGG - Intergenic
1031732379 7:125315033-125315055 GTTCCATTTTTACAGAGTGCTGG - Intergenic
1031956449 7:127947371-127947393 GTTATATTCTTTCAGATTTCAGG + Intronic
1036296015 8:7538076-7538098 CCTACATTCTTTCTGGCTGCGGG - Intergenic
1036326551 8:7782943-7782965 CCTACATTCTTTCTGGCTGCGGG + Intergenic
1037057956 8:14468082-14468104 CTTACATTTTTTCAAAGAGGTGG + Intronic
1038086640 8:24205205-24205227 CTTACATTCTTCCACAGTGATGG + Intergenic
1042014054 8:64286809-64286831 CTTAAATTAATTCAGAGTGGAGG + Intergenic
1043085547 8:75827232-75827254 CTTGCATTCTTTGAAACTGCAGG - Intergenic
1043286995 8:78544670-78544692 CTTAAATGCTTTCAGAGGTCAGG + Intronic
1043857983 8:85283675-85283697 CTTACATTCTTCCAGAAAACAGG - Exonic
1044951638 8:97441088-97441110 TTTTCATTCTTTCAGAGTTCTGG - Intergenic
1045131105 8:99154010-99154032 CTTACATTGTTTTTGAGTGGAGG + Intronic
1045315308 8:101038858-101038880 CTTCCTTTCTTTGAGAGTCCAGG + Intergenic
1047339660 8:123968629-123968651 CTTAAACTTTTTCAGAGTCCTGG - Intronic
1048550044 8:135425718-135425740 CATACATTCATTCATAGTGTAGG + Intergenic
1050416072 9:5418940-5418962 CTGACATTCTAGCAGAGTCCTGG + Intronic
1053440744 9:38114418-38114440 CTTACAGCCTCTCAAAGTGCTGG + Intergenic
1058454801 9:105129124-105129146 CTGGGATTCTTGCAGAGTGCAGG - Intergenic
1062418261 9:136465007-136465029 CTTGGATCCTTTCAAAGTGCTGG - Intronic
1185989863 X:4881638-4881660 CTGGCATCCTTTCAGAGTTCTGG + Intergenic
1189136845 X:38559410-38559432 CTTTCATTCTTACAGACTCCAGG - Intronic
1190749411 X:53348176-53348198 CTGACATTTTTGGAGAGTGCAGG - Intergenic
1193977942 X:88146538-88146560 CTGACATTTTTGCAGAGAGCTGG - Intergenic
1194051224 X:89071379-89071401 CTTACATTTTAGCAGAGTTCAGG + Intergenic
1195281412 X:103338325-103338347 TTTGCATTCTCTCAGAGTGCAGG - Intergenic
1199315522 X:146373018-146373040 CTTACAGTGGTTCAGAGTACAGG + Intergenic
1199379641 X:147155230-147155252 TTCACATTCTCCCAGAGTGCAGG - Intergenic
1199444024 X:147900357-147900379 CTTACTTTCTTGTAGAGTGGTGG + Intergenic