ID: 1010800091

View in Genome Browser
Species Human (GRCh38)
Location 6:80165281-80165303
Sequence CAAGCTACTCACAGTCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010800089_1010800091 23 Left 1010800089 6:80165235-80165257 CCACTGAGTTTTTGGTTCACTGG 0: 1
1: 0
2: 0
3: 37
4: 256
Right 1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010800091 Original CRISPR CAAGCTACTCACAGTCAAAT AGG Intronic
902603938 1:17558397-17558419 CAAGGAACTCACAGTCTAGTGGG + Intronic
908539461 1:65109117-65109139 CAAGCAGCTCACAGTCTAGTAGG - Intergenic
910675728 1:89814805-89814827 CATGCAACTCACATTGAAATAGG - Intronic
910869833 1:91823065-91823087 CAAGGAGCTCACAGTCTAATGGG + Intronic
911466933 1:98266599-98266621 CAAGTTACTTACAGTCCAATGGG - Intergenic
911744800 1:101429248-101429270 AAAGGTACTCACTGTGAAATTGG - Intergenic
911770528 1:101735388-101735410 CAAGGAATTCACAGTCACATGGG + Intergenic
916671367 1:167024235-167024257 CAAGGAACTCACAGTTTAATGGG + Intergenic
917200281 1:172507496-172507518 CAAGCTGTGCACAGCCAAATAGG - Intergenic
917742818 1:177977593-177977615 CATGATACACACAGTCACATGGG + Intronic
917961955 1:180152821-180152843 CAAGGTACTAACACTCCAATTGG + Intergenic
921519471 1:216141653-216141675 CAAGCCACTCAAAGTCTAAAGGG - Intronic
923010484 1:230084122-230084144 CAAGACACTCACAGTCCACTGGG - Intronic
923483138 1:234403539-234403561 CATGTGACTCACAGTCAAATGGG - Intronic
924635415 1:245782651-245782673 CTAGATACTCACAGTCAAAACGG + Intronic
1063634221 10:7766406-7766428 CCAGCTCCTGACAGTCACATGGG - Intronic
1064314626 10:14243867-14243889 CAATCTAATTACATTCAAATAGG + Intronic
1064414918 10:15140690-15140712 CAAGAAACTCACAGTGAAAAGGG - Intronic
1069097295 10:64274516-64274538 CAAGCCACTAACAATCCAATTGG + Intergenic
1071781939 10:88855704-88855726 CTAGCTACTTACTGTAAAATTGG + Intergenic
1073223628 10:101897313-101897335 AAAGCTACTTACAGTGAAACTGG - Intronic
1074193738 10:111161154-111161176 CAAGATAATCACTGTCAATTGGG - Intergenic
1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG + Intergenic
1076036745 10:127204917-127204939 CAGGCCACCCACAGTCAAATGGG - Intronic
1079435514 11:20443769-20443791 CAAAAGACTGACAGTCAAATTGG - Intronic
1079928825 11:26531948-26531970 CAAGGTACACCCAGTCTAATGGG + Intronic
1080008478 11:27433989-27434011 CAGGTTCCTCACAGTCAAATGGG + Intronic
1080373717 11:31682917-31682939 CAAGAAACTTACCGTCAAATGGG - Intronic
1080864193 11:36178903-36178925 CAAGACACTTACAATCAAATTGG - Intronic
1081424212 11:42907183-42907205 CAAGAGGCTCACAGTCTAATGGG + Intergenic
1084676466 11:70638292-70638314 CAAGCTACTCCCAGTGACAGAGG + Intronic
1086078999 11:82883130-82883152 CAGGCTGCTCACAGTCTAACAGG + Intronic
1086540569 11:87905079-87905101 GAAGCTACTCAAACTGAAATAGG - Intergenic
1087372685 11:97304795-97304817 CTAGGTACTCAGAGTCAAACAGG + Intergenic
1093373142 12:18388592-18388614 CAACCTACGCACAGTCCAAGTGG + Intronic
1093417696 12:18939281-18939303 CAAGGGACTCCCAGGCAAATAGG - Intergenic
1093970028 12:25367845-25367867 CAAGCAACTCACATTAAAATGGG - Intergenic
1094318811 12:29162443-29162465 TAGGCTATTCACAGTCAAAATGG - Intronic
1095803774 12:46296280-46296302 CATGCTACACATAGTCCAATTGG + Intergenic
1100736195 12:97535537-97535559 CAAGAAACTCACACTCAGATTGG + Intergenic
1101797904 12:107992894-107992916 TAAGGAACTCACAGTCTAATTGG + Intergenic
1102103674 12:110301426-110301448 CAAGTTTCTCACAGTTAATTAGG - Intronic
1108760041 13:53551956-53551978 CAAGCTTCTCACAATAAAAGTGG + Intergenic
1109053024 13:57508689-57508711 CAAACTACTCCCAAACAAATTGG + Intergenic
1109440290 13:62361902-62361924 CAAGTAACTGACAGTCAAATAGG - Intergenic
1109628604 13:65013290-65013312 AAACCTACTCATAGTCAAAGGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1115439714 14:33418973-33418995 CAAGGTACTTACAGTCTAGTTGG + Intronic
1118001653 14:61528596-61528618 CAAGGAACTCACAGTGTAATGGG - Intronic
1120666267 14:87310117-87310139 CAAGCTTCTCAAAGTTACATGGG + Intergenic
1121052160 14:90826592-90826614 CAAGGAACTCACAGTCTAGTGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124255376 15:28137344-28137366 AAAGCAAGGCACAGTCAAATGGG - Intronic
1127301158 15:57655162-57655184 CAATCTACCCACAGTCACCTAGG - Intronic
1127678684 15:61271394-61271416 CAAGTAGCTCACAGTCCAATAGG + Intergenic
1130300179 15:82674592-82674614 CCAGATACTCACAGCCAAGTAGG - Intronic
1130539945 15:84815320-84815342 CAAGAAGCTCACAGTCTAATAGG - Intergenic
1130980418 15:88808463-88808485 CCACCTACTTACAGTCTAATGGG + Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1139333289 16:66210937-66210959 CAAGGAGCTCACAGTCTAATGGG - Intergenic
1139459511 16:67110405-67110427 CGAGCAACTGACAGGCAAATCGG - Intronic
1140099292 16:71900790-71900812 CAAGGGGCTCACAATCAAATGGG - Intronic
1141134100 16:81454694-81454716 CAAGGGACTCATAGTTAAATGGG + Intronic
1145775256 17:27523462-27523484 CAAGTTGCTCGCAGTCTAATGGG + Intronic
1147665864 17:42147664-42147686 AAAGTTGCTCACAGACAAATGGG - Intronic
1149402522 17:56312778-56312800 CATGCAACTCACAGTCTAAAAGG + Intronic
1149907737 17:60542120-60542142 TCAGTTACTCACAGTCAACTGGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1155630819 18:27890054-27890076 CAAGGTGCTCAGAGTCAAATAGG - Intergenic
1157434181 18:47654604-47654626 CAAGATAGTAACAGACAAATGGG - Intergenic
1158115239 18:53987828-53987850 CAAGATACTGACATTCATATAGG - Intergenic
1160621955 18:80177937-80177959 CAAGATAATCACAGTCCAAATGG + Intronic
1166078275 19:40426398-40426420 CAAGCTACACAAAGTTAAATGGG + Intergenic
926621697 2:15052043-15052065 CAAGATACTCATAGTCAAGAAGG - Intergenic
927305744 2:21570589-21570611 CCAGATTCTCACAGTGAAATTGG - Intergenic
931007390 2:57867380-57867402 GAAATTACTCACAGGCAAATAGG + Intergenic
935126128 2:100224385-100224407 CCATCTGCTTACAGTCAAATCGG + Intergenic
935195998 2:100817056-100817078 CAAAGTTCTCACAGTCAAATTGG - Intergenic
938240194 2:129737543-129737565 CAAGGAACTCAGAGTCAAGTTGG + Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939124839 2:138165342-138165364 CACTCTACACACAGGCAAATCGG + Intergenic
940113823 2:150185173-150185195 CAAGATAATCACAGTCTTATGGG - Intergenic
942219638 2:173756619-173756641 CAAGCTGGTCACAGTGACATAGG + Intergenic
945466362 2:210174442-210174464 CAAGCAACTCACAGCCAAGAAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1173834372 20:46115638-46115660 CAGGGAGCTCACAGTCAAATGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1182177777 22:28310197-28310219 CAAGGTGCTCACAGTCAAGAGGG + Intronic
1182738177 22:32546189-32546211 CAAGAAGCTCACAGTCTAATGGG - Intronic
1183225064 22:36544053-36544075 CAAGTAACTCAGAGTCTAATGGG + Intergenic
1183311851 22:37114200-37114222 CATGGGACTCACAGTCAAAAGGG - Intergenic
1185138616 22:49088052-49088074 CAAGCTGCCCAATGTCAAATGGG - Intergenic
950912894 3:16613689-16613711 CAAGCAACTCAAAGGGAAATTGG - Intronic
951098366 3:18657913-18657935 CAAGCGACTAACAAGCAAATGGG - Intergenic
951538407 3:23760566-23760588 CTTACCACTCACAGTCAAATTGG - Intergenic
953234849 3:41097111-41097133 CAAACTGCTCAGAGTCAAACAGG + Intergenic
953870118 3:46619025-46619047 CTGGCTACCCAGAGTCAAATCGG - Intronic
955296811 3:57743134-57743156 CAAAATACTCACAGTCTAATAGG + Intergenic
955790012 3:62579422-62579444 CAAGGAACTCACAGTCTAGTGGG + Intronic
958004529 3:87794109-87794131 CAAGAAACACACAGACAAATGGG - Intergenic
958729776 3:97949334-97949356 CAGGCTACTCACAGTGGAAGGGG - Intronic
960457571 3:117891786-117891808 AAAGCTACTTATAGTCTAATGGG + Intergenic
960510791 3:118546726-118546748 CAAGTTTCTCACAGTCTAGTGGG - Intergenic
960971291 3:123141909-123141931 CAAGCCAATCACTGTCCAATGGG - Intronic
963558643 3:146831444-146831466 CAAGAGACTTACAGTAAAATGGG + Intergenic
965797413 3:172455229-172455251 CAAATTACTTACAGTCACATTGG - Intergenic
966287835 3:178318639-178318661 CTAGCTACTCACAGGCAAGAGGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
969083418 4:4637754-4637776 CAAGCACCTCATAGTCTAATGGG - Intergenic
971996252 4:33968493-33968515 AAATCTACACACAGTCAATTTGG + Intergenic
972925890 4:44006801-44006823 CAGGCTACTCATAGTTAAAAGGG + Intergenic
976345516 4:83995096-83995118 CAAGCTACTGTCACTCATATTGG + Intergenic
982547432 4:156752000-156752022 AAAGATACTCAAAGTAAAATTGG + Intergenic
984100656 4:175481556-175481578 CAAGCTATTCACAGACCAAAGGG - Intergenic
986117033 5:4785368-4785390 CTAGCTGCTGACTGTCAAATAGG + Intergenic
986921384 5:12687762-12687784 GAAGCTTCTCATAGTCGAATTGG - Intergenic
988809500 5:34770449-34770471 CATGGTACACACAGTCTAATAGG + Intronic
990095959 5:52113379-52113401 CAAGCTAATCACAACCAAAAAGG - Intergenic
990994779 5:61720978-61721000 CAAGGTACTCACAGTCCAGTAGG + Intronic
991476179 5:67022079-67022101 CAAGACACTCACAGTCAGCTTGG - Intronic
995464988 5:112442258-112442280 CAAGCAGCTCACAGTCCAATAGG - Intergenic
996739638 5:126787112-126787134 CAAGTTACTTACAGTCTAGTGGG + Intronic
1001160879 5:169311603-169311625 CAAGAGACTCACAGTCTAACTGG - Intergenic
1001420406 5:171581957-171581979 CACGCAACTCACAGTCCATTTGG + Intergenic
1002424778 5:179168448-179168470 CAGGGTCCTCACTGTCAAATGGG + Intronic
1005287479 6:24343717-24343739 CAAGCTCCTCTCAGTTCAATAGG + Intronic
1005312073 6:24568338-24568360 CAGGCAGTTCACAGTCAAATGGG + Intronic
1007027652 6:38593678-38593700 CAAGGTAGTGACAATCAAATAGG - Intronic
1007256219 6:40530761-40530783 CAAGCTCCTCACACTCACTTCGG + Intronic
1007280978 6:40712261-40712283 CATGAAACTCACAGTCCAATGGG - Intergenic
1007494040 6:42246997-42247019 CAAGATGCTCACAGTCTACTGGG + Intronic
1007930241 6:45684314-45684336 CAAACTGCTCAAAGTCATATAGG + Intergenic
1010061311 6:71625916-71625938 CATGCAACTCACAATCCAATAGG - Intergenic
1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG + Intronic
1011499255 6:87969736-87969758 CAAAGAACTCAGAGTCAAATGGG - Intergenic
1012324756 6:97903166-97903188 ACATCTACTCACAGTCAATTAGG - Intergenic
1012895189 6:104940060-104940082 TAAGATACTCAACGTCAAATTGG - Intergenic
1013434336 6:110087044-110087066 CAAGATTTTCACAGTCTAATTGG + Intergenic
1013590888 6:111618943-111618965 CAAGCAAGTCAGAGTCAAATAGG - Intergenic
1016631575 6:146239442-146239464 CAAGGAACTCACAGTTCAATGGG - Intronic
1019502879 7:1373958-1373980 CAAGAAACTCACAGTCACAGTGG + Intergenic
1020863008 7:13518339-13518361 CTAGCTAATCACAGTCCCATAGG + Intergenic
1022140324 7:27487835-27487857 CAAGTTACCCAAAGTCAACTGGG + Intergenic
1023523746 7:41076142-41076164 CAAGATAGTGTCAGTCAAATCGG + Intergenic
1032348280 7:131136950-131136972 CAAGAAACTCACAGTCCAATGGG - Intronic
1032563141 7:132913271-132913293 CAAGGATCTCAAAGTCAAATGGG + Intronic
1033378873 7:140792702-140792724 CAAGGAAGTCACAGTCTAATAGG - Intronic
1033904100 7:146179997-146180019 CAAGCCATTCACAGTTAAACAGG + Intronic
1036795522 8:11753700-11753722 CCATCTACCCACAGTTAAATAGG + Intronic
1037261702 8:17016765-17016787 CAAACTCTTCACAGGCAAATAGG + Intergenic
1037315643 8:17596301-17596323 CAGGCTGCTCACAGGCACATGGG + Intronic
1039335903 8:36589117-36589139 CAAGCACCTCACAGTAAAAATGG + Intergenic
1039838305 8:41275474-41275496 CAAGCTAGTCACAGTGAGACTGG + Intronic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1043375149 8:79640640-79640662 CAAGATGCTTACAGTCTAATGGG - Intronic
1043802960 8:84634483-84634505 CCAGCAACTCACAGTCCAATAGG - Intronic
1043870863 8:85430660-85430682 ATAGCTACTCACGCTCAAATTGG + Intronic
1044751142 8:95416738-95416760 TCAGCTACTCACCTTCAAATAGG - Intergenic
1045660711 8:104434662-104434684 CAAGCAGCTCACAGTAAACTGGG - Intronic
1049029154 8:140021151-140021173 CAAGGAACGTACAGTCAAATAGG - Intronic
1050389350 9:5122248-5122270 CATGATACTCACAGTCCACTAGG + Intronic
1051438835 9:17060763-17060785 AATGCTACTAACAGTCAAAGTGG - Intergenic
1052983258 9:34464665-34464687 CAAGGAGCTCACAGTCTAATGGG - Intronic
1056178463 9:84058699-84058721 CAATATACTCACAGTATAATTGG + Intergenic
1058752776 9:108055138-108055160 CAAGAAGCTCACAGTCAACTGGG + Intergenic
1059591185 9:115664264-115664286 CAAGTAGCTCACAGTCAAGTAGG - Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186083646 X:5962101-5962123 GCAGTTACACACAGTCAAATGGG + Intronic
1187677090 X:21727034-21727056 CAAGGGACTCACAGTCTAGTTGG - Intronic
1189089864 X:38070328-38070350 AAAGCAACTGAGAGTCAAATAGG - Intronic
1196131350 X:112160302-112160324 CAAGGAACTCACAGTCCACTGGG + Intergenic
1197383016 X:125768636-125768658 CAATCTCCTCACCGTTAAATTGG - Intergenic
1198656766 X:138923241-138923263 TAAGGTACTCACAGTGAGATGGG + Intronic