ID: 1010800091

View in Genome Browser
Species Human (GRCh38)
Location 6:80165281-80165303
Sequence CAAGCTACTCACAGTCAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010800089_1010800091 23 Left 1010800089 6:80165235-80165257 CCACTGAGTTTTTGGTTCACTGG No data
Right 1010800091 6:80165281-80165303 CAAGCTACTCACAGTCAAATAGG 0: 1
1: 0
2: 0
3: 16
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010800091 Original CRISPR CAAGCTACTCACAGTCAAAT AGG Intronic