ID: 1010806979

View in Genome Browser
Species Human (GRCh38)
Location 6:80248859-80248881
Sequence CTATAGATAGATACCCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010806976_1010806979 -4 Left 1010806976 6:80248840-80248862 CCAGACTTGCCATGTTTTTCTAT 0: 1
1: 0
2: 1
3: 26
4: 288
Right 1010806979 6:80248859-80248881 CTATAGATAGATACCCTGGTTGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010806979 Original CRISPR CTATAGATAGATACCCTGGT TGG Intronic
903384733 1:22918933-22918955 CTACAGACAGATGGCCTGGTTGG - Intergenic
905046507 1:35007628-35007650 CTTTAGATAGATTCCCTTATTGG - Intronic
909608624 1:77531461-77531483 CTGTATCTAGCTACCCTGGTGGG - Intronic
911567558 1:99481203-99481225 ATATACATAGATACGTTGGTGGG - Intergenic
915865450 1:159494396-159494418 CTATATCTAGCTACTCTGGTGGG - Intergenic
916728200 1:167542772-167542794 CTAGAGATGGATTCCCTGGTTGG - Intronic
923573922 1:235140866-235140888 CTATATCTAGCTACTCTGGTGGG + Intronic
1070984098 10:80673402-80673424 CTATATCTAGATACTCTGGCTGG + Intergenic
1071040971 10:81308703-81308725 CTATATCTAGCTACTCTGGTGGG - Intergenic
1073359970 10:102890308-102890330 CTTTAGATATATACCCAAGTAGG + Intronic
1076555246 10:131317341-131317363 CTATAGATAGGTAGACGGGTAGG - Intergenic
1077815700 11:5683479-5683501 CTATATCTAGCTACTCTGGTGGG + Intronic
1080557587 11:33431490-33431512 CTATATCTAGCTACTCTGGTGGG - Intergenic
1081421002 11:42874485-42874507 CTGTATCTAGCTACCCTGGTGGG + Intergenic
1082270328 11:50163634-50163656 CTGTATATAGCTACTCTGGTGGG - Intergenic
1084210584 11:67619769-67619791 CTGTATCTAGCTACCCTGGTGGG + Intergenic
1090772674 11:129934982-129935004 GTATAGATAGGTAACCAGGTGGG - Intronic
1098747248 12:74254137-74254159 CTATAGATGGATGTGCTGGTAGG - Intergenic
1102434323 12:112908901-112908923 CTTTAGAGAGATGCCCTGTTGGG - Intronic
1102869789 12:116404932-116404954 CCATAGATAGATATACTGATTGG + Intergenic
1104567918 12:129902350-129902372 CTGCAGATAGATACACTGGGAGG - Intronic
1108409418 13:50131786-50131808 ATATATATAGGTACCCTGATAGG - Intronic
1110609721 13:77475284-77475306 CTGTATCTAGCTACCCTGGTGGG - Intergenic
1114601477 14:23958981-23959003 CTGTAGAAAGTTACCCTGGAGGG - Intronic
1114611167 14:24041750-24041772 CTGTAGAAAGTTACCCTGGAGGG - Intergenic
1115967836 14:38912035-38912057 GTATAGCTAGAGACCCTGGTTGG - Intergenic
1118636498 14:67753024-67753046 CCACACACAGATACCCTGGTAGG - Intronic
1127090824 15:55465246-55465268 CTCTAGATAGATACCCAGTAGGG - Intronic
1129504421 15:76069516-76069538 CAACAGAAACATACCCTGGTGGG + Intronic
1137508434 16:49076991-49077013 CTGTAGAAAGTTAGCCTGGTTGG - Intergenic
1139676528 16:68527474-68527496 CTGTATCTAGTTACCCTGGTGGG + Intergenic
1150021738 17:61622021-61622043 CTATTGATACATACCCAGTTTGG - Intergenic
1151832149 17:76559677-76559699 CTATTAATAAATACCCTGGCTGG + Intergenic
1155271852 18:24149300-24149322 CTGTATCTAGATACTCTGGTGGG - Intronic
1158460617 18:57643248-57643270 CTATATCTAGCTACTCTGGTGGG - Intergenic
1159208390 18:65283279-65283301 CTATAGATAGATAGATAGGTAGG + Intergenic
1160176508 18:76599799-76599821 CTATATCTAGCTACTCTGGTGGG - Intergenic
1163933398 19:20420622-20420644 CTATAGATAGTAGCCCAGGTGGG + Intergenic
1164095352 19:22004985-22005007 CTATAGATAGTGGCCCAGGTGGG + Intronic
1164114829 19:22209716-22209738 CTATAGATAGTGGCCCAGGTGGG + Intergenic
1164811086 19:31156504-31156526 CTTTAAATAGATGCCCTGGGTGG - Intergenic
1166458441 19:42964642-42964664 CTATGGATAGAAACCAAGGTGGG - Intronic
926308936 2:11660438-11660460 ATGCAGATAGATAACCTGGTAGG - Intronic
929969925 2:46565219-46565241 CTATATAGAGAGTCCCTGGTTGG - Intronic
933506416 2:83181613-83181635 CTATATCTAGCTACTCTGGTGGG + Intergenic
935499268 2:103818473-103818495 CTATAGAAAGATACATTTGTTGG + Intergenic
939281859 2:140074393-140074415 CTGTATCTAGCTACCCTGGTGGG + Intergenic
939497094 2:142937136-142937158 CAGAAGATAGCTACCCTGGTTGG - Intronic
944876942 2:203971982-203972004 CTAAATATAGAAACCCAGGTTGG - Intergenic
1168960852 20:1868633-1868655 CTATTGATAGTTACCATGTTAGG - Intergenic
1175320912 20:58087648-58087670 CTACAGATACAGACACTGGTTGG - Intergenic
1177399872 21:20588527-20588549 ATATATATATATACCCTGGAGGG + Intergenic
949259126 3:2084570-2084592 CTATATCTAGCTACTCTGGTGGG + Intergenic
950600240 3:14028930-14028952 CTATATCTAGATACTCTGGTGGG - Intronic
956023095 3:64952965-64952987 CCATAAAGAGATACCCTGATGGG + Intergenic
964281682 3:155073785-155073807 CTATAGATAGATAGACAGATAGG - Intronic
964340292 3:155701436-155701458 CTGTAGAAAGAGACCCTGGCTGG + Intronic
968469771 4:774143-774165 CTGTATCTAGCTACCCTGGTGGG + Intergenic
973852401 4:54974168-54974190 CTATAGATACATACACAGGAAGG + Intergenic
974236528 4:59188429-59188451 CCATAGAAAGATACATTGGTAGG + Intergenic
979841362 4:125445423-125445445 CAACAAATAGATACCCTTGTTGG - Intronic
981050430 4:140304377-140304399 TTCTAGTTAGATATCCTGGTAGG + Intronic
982463560 4:155702063-155702085 CTATGGATAGGTACCATTGTAGG + Intronic
991092647 5:62707936-62707958 CTATAGAAAAATACCAAGGTGGG - Intergenic
993976534 5:94489458-94489480 CTTTAGATAAAAACCCTTGTGGG + Intronic
994841499 5:104929616-104929638 CTATATCTAGCTACTCTGGTGGG + Intergenic
997352330 5:133239734-133239756 CTGTATCTAGATACTCTGGTGGG + Intronic
1000100954 5:158015715-158015737 CCATTGATAGACACCCAGGTTGG + Intergenic
1000609239 5:163356428-163356450 CTGTAGCTAGCTACTCTGGTGGG + Intergenic
1003070315 6:2940210-2940232 CTATATCTAGCTACTCTGGTGGG + Intergenic
1003748117 6:9024840-9024862 CTATATCTAGCTACTCTGGTGGG + Intergenic
1005059395 6:21761774-21761796 CTATATCTAGCTACTCTGGTGGG + Intergenic
1005641371 6:27799760-27799782 CTATAGAAATATAACCTGGTTGG + Intergenic
1008419424 6:51280162-51280184 CTATATCTAGCTACTCTGGTGGG + Intergenic
1010806979 6:80248859-80248881 CTATAGATAGATACCCTGGTTGG + Intronic
1012839763 6:104315351-104315373 CTTTAGCTATAGACCCTGGTGGG - Intergenic
1013205103 6:107937450-107937472 CTATTGATAGACACCTGGGTTGG + Intronic
1014348689 6:120310583-120310605 CTTTAGATAGATACCCAGTAGGG + Intergenic
1015471031 6:133606670-133606692 CTATACATAGATACAGTTGTGGG - Intergenic
1020552179 7:9621233-9621255 CTGTATATAGCTACTCTGGTGGG - Intergenic
1024443938 7:49454247-49454269 CTATATCTAGCTACTCTGGTGGG + Intergenic
1028229251 7:88287011-88287033 CTACAGACAGACACCCTGGGAGG + Intronic
1032490873 7:132323245-132323267 CAACAGACAGATGCCCTGGTGGG + Intronic
1038195831 8:25366603-25366625 CTATAAATAGATACACTTCTTGG + Intronic
1039587712 8:38720415-38720437 CTATATCTAGCTACTCTGGTGGG + Intergenic
1040723228 8:50350533-50350555 CTATATCTAGCTACTCTGGTGGG + Intronic
1045889853 8:107142879-107142901 CTATAGAAAGATACCATGCTTGG + Intergenic
1048106634 8:131418245-131418267 CTATGGAGAGGTACCCTTGTAGG + Intergenic
1051435643 9:17028006-17028028 CTATTGATGGATATCCAGGTTGG + Intergenic
1051791716 9:20811465-20811487 CTATAGAAAGATTGTCTGGTTGG + Intronic
1051893196 9:21964575-21964597 CTACAGATTGATATCCTTGTTGG - Intronic
1053027170 9:34739932-34739954 CTATATCTAGCTACTCTGGTGGG - Intergenic
1059905169 9:118975610-118975632 CTATAGAAAGAAACACAGGTGGG - Intergenic
1189867683 X:45348395-45348417 CTGTAGATAGATATACTGTTGGG + Intergenic
1193148456 X:78101527-78101549 CTCTAGAGAGACACCCTTGTTGG - Intronic
1201679756 Y:16631721-16631743 CTATAGATAGATAGGTAGGTAGG - Intergenic