ID: 1010807762

View in Genome Browser
Species Human (GRCh38)
Location 6:80259049-80259071
Sequence CTGAAACAGTTCAGTATTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010807759_1010807762 22 Left 1010807759 6:80259004-80259026 CCTGGCATGGGGAGTGGTATCAT 0: 1
1: 0
2: 0
3: 9
4: 116
Right 1010807762 6:80259049-80259071 CTGAAACAGTTCAGTATTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010807762 Original CRISPR CTGAAACAGTTCAGTATTGA AGG Intronic
No off target data available for this crispr