ID: 1010811141

View in Genome Browser
Species Human (GRCh38)
Location 6:80300078-80300100
Sequence CAGTCTGGGCAGTGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 291}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010811141_1010811149 30 Left 1010811141 6:80300078-80300100 CCATATTCCCACTGCCCAGACTG 0: 1
1: 0
2: 2
3: 28
4: 291
Right 1010811149 6:80300131-80300153 ATCCTTGACTTCCAGAGCCCAGG 0: 1
1: 0
2: 3
3: 51
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010811141 Original CRISPR CAGTCTGGGCAGTGGGAATA TGG (reversed) Intronic
901834074 1:11912365-11912387 CAGTCAGGGCTGCGGGACTATGG - Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902615339 1:17620598-17620620 CAGGCAGGGCAGTGGGAAGATGG + Intronic
904232148 1:29084166-29084188 CAGAGATGGCAGTGGGAATAGGG - Intronic
904256229 1:29256740-29256762 GAGGCTGGGCCCTGGGAATATGG - Intronic
905172760 1:36118752-36118774 CAGTCTGGAAAGTTGGAATGGGG - Intronic
905213864 1:36393123-36393145 CAGTCTGGTCAGGTGGAAAATGG - Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905865650 1:41375094-41375116 GATCCTGGGCAGTGGGACTAGGG - Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
907571136 1:55485091-55485113 TAGGTTGGGCAGTGGGAATCGGG + Intergenic
910262269 1:85304120-85304142 CAGTCTGGGCCATGTGAAAAGGG - Intergenic
910355864 1:86353823-86353845 CAGTGTGGGCAATGGTAACAGGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
910835903 1:91509851-91509873 CAGTCTGGGCAGTGGCCCTGAGG - Intronic
911168393 1:94745394-94745416 CATTCAGAGCAGTGGGAATGGGG + Intergenic
914687887 1:149998071-149998093 CAGTCTGGGTAATAGCAATAAGG - Intronic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915331643 1:155116482-155116504 GAGTTTGGGCAGGGGGAATAGGG - Intergenic
915674520 1:157517968-157517990 CTGTCTGGAAAATGGGAATAGGG + Intronic
915836940 1:159184493-159184515 CAGTCAGGGAAGTGGGACTCTGG + Intronic
918106417 1:181419208-181419230 CTGGCTGGGCAGGGGGAAGAGGG - Intronic
918302134 1:183214237-183214259 CATGCTGGGCAGTGGGAATACGG + Intronic
919186251 1:194154464-194154486 CATTTTGGGCTGAGGGAATACGG + Intergenic
919230658 1:194769101-194769123 GAGTCGGGGAAGTGGGAAGAAGG + Intergenic
919818375 1:201456434-201456456 CAGACTGGGTAGTGAGATTAGGG + Intergenic
921766464 1:218978439-218978461 CTCTCTGGGCTGTGGGATTATGG - Intergenic
922370586 1:224906858-224906880 CAGAGTGGGCTGAGGGAATATGG + Intronic
923848365 1:237763615-237763637 CATTCTATGCAGTGGAAATAAGG + Intronic
1063461063 10:6215339-6215361 AGGGCTGGGCTGTGGGAATAAGG + Intronic
1063461085 10:6215415-6215437 AGGGCTGGGCTGTGGGAATAAGG + Intronic
1064110695 10:12536167-12536189 CAGTCTGGGTGGTGGGTACATGG - Intronic
1064712782 10:18143313-18143335 CAGTTTGGGCCGAGGTAATAAGG + Intronic
1064953367 10:20879589-20879611 CACTCTGCACAGTGGGACTATGG + Intronic
1065047403 10:21756918-21756940 CGGTCTGGGCAGTGCGAGAAGGG + Intronic
1066244605 10:33570384-33570406 CAGTGTGGGCAGTGGGGACCAGG + Intergenic
1067833634 10:49624630-49624652 CATTCTGGGATGTGGGGATATGG - Intronic
1069867578 10:71513224-71513246 CAGTGTGGCCAGTGGGGATGTGG + Intronic
1070793335 10:79202738-79202760 CAGCCTGGGCAGTGGGAGCTGGG - Intronic
1070977645 10:80618037-80618059 CAGTCTGTGCAGTTCCAATAGGG - Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1073030069 10:100519196-100519218 CAGTCTAGGAACTGGGAAAATGG + Intronic
1073153664 10:101329412-101329434 CAGTCTGGGCATGGGGAAAGGGG - Intergenic
1073291384 10:102414936-102414958 CAGCCTCGGCAGTGGCAATGAGG - Exonic
1073576032 10:104624385-104624407 GAGTCTGGGGTTTGGGAATATGG + Intergenic
1074082945 10:110182231-110182253 CTGTCTGGGCAGGAGGAAGAAGG - Intergenic
1074565417 10:114573129-114573151 CAGTATGGGCAGAGGATATAGGG - Intronic
1074822119 10:117187622-117187644 AAGTCTAGCCAGTGGGAAAAGGG - Intergenic
1075387105 10:122062852-122062874 CAGGCTGGGCATTGGGCCTAGGG + Intronic
1075615793 10:123890386-123890408 CAGCCAGGGCAGTGGGAAAGTGG - Intronic
1075952454 10:126493278-126493300 CTCTCTGGGCAGTAGGATTATGG + Intronic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076441545 10:130484307-130484329 CAGGCTGGGCATCGGGAATAAGG + Intergenic
1077233766 11:1470219-1470241 CAGTGGGGGCAGTGGGGATGGGG - Exonic
1078221914 11:9358503-9358525 GATTCTGGGTGGTGGGAATATGG - Intergenic
1080462857 11:32471027-32471049 GATTCTGGACAGTGGGAAGATGG - Intergenic
1080504483 11:32898949-32898971 CAGTCTGGGAGGTGGGGATAGGG - Intronic
1080580974 11:33643360-33643382 CTCTTGGGGCAGTGGGAATAGGG + Intronic
1080690077 11:34549121-34549143 CAGTTTGGGCAGGGAGAAAATGG - Intergenic
1081144577 11:39546900-39546922 TAGTCTGGGAAGTGAGAACATGG - Intergenic
1082779459 11:57275465-57275487 AAGTCTGGGCAGAGTGAATGTGG - Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1084380253 11:68807408-68807430 CAGTTTGGGCTTTGGGAAGAAGG - Intronic
1084840110 11:71839769-71839791 CAGTGTCCACAGTGGGAATATGG - Intergenic
1085509627 11:77081740-77081762 CAGTCTGGATAGTGGGGATGTGG + Intronic
1085519618 11:77130434-77130456 CAGGCTGGGCAGTGGTCAGAGGG + Intronic
1086498201 11:87425495-87425517 CTGTCAGGGCAGAGGGAATGAGG + Intergenic
1087630060 11:100639399-100639421 CCGCCTTGGCAGTGGGAAAATGG - Intergenic
1088895762 11:114077209-114077231 CAGGCTGGGGAGGGGGAAAATGG - Intronic
1088908654 11:114173619-114173641 CAATCTGGGCAGTGAGTAAAGGG + Intronic
1090434934 11:126678731-126678753 GAGACTGGGCAGTGGACATAGGG - Intronic
1093304753 12:17501280-17501302 TAGTCTGGGCAGTGAGAATGGGG - Intergenic
1093436437 12:19140151-19140173 CCGTCTGGGGAGTGGGATGATGG + Intronic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1094493827 12:30977310-30977332 GAGTGTGGGCAGGGGGGATACGG - Intronic
1095796871 12:46229196-46229218 CATTATGGGCAGTGGGATTTTGG - Exonic
1096470138 12:51870370-51870392 GTGTCTGGGCAGTGGGGAGAAGG - Intergenic
1096481966 12:51948277-51948299 CACTCTAGTCAGTGGGACTAAGG + Intergenic
1096564351 12:52464997-52465019 TTGTGTGGGCAGTGGGTATATGG + Intergenic
1097185869 12:57196024-57196046 CAGTCTGGGGAGGGGGCAGAGGG - Intronic
1097282496 12:57853282-57853304 CAGTCTGGGCTGGGGGTACAGGG - Intergenic
1097393338 12:59042308-59042330 CAGGCTGGGCACTGGAAAAAGGG - Intergenic
1101758178 12:107637905-107637927 CAGTCTGGGAAGCAGGAATGGGG + Intronic
1103702582 12:122855486-122855508 CAGGCCGGGCAGTGGGCAAAGGG - Intronic
1104536358 12:129621490-129621512 CATTTTGGCCAGTGGGGATATGG - Intronic
1106088815 13:26568036-26568058 CAGGGAGGGCAGTGTGAATAGGG + Intronic
1106360437 13:29026069-29026091 GCGGTTGGGCAGTGGGAATAAGG + Exonic
1107445469 13:40466552-40466574 CAGTCAGGCCAGTGGGGAAATGG - Intergenic
1107655197 13:42585727-42585749 CAGTCTGGCCAGGGGGTCTATGG - Intronic
1107694745 13:42989418-42989440 CAGTGTGGGGATTAGGAATATGG - Intronic
1107986673 13:45782183-45782205 CAGCCTGCGCAGAGGAAATATGG + Exonic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110963639 13:81662395-81662417 CAGTCTAGGCAGTAAGAAAAGGG + Intergenic
1111665102 13:91257245-91257267 CAGTCTGGCCAGATGAAATATGG - Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113404075 13:110021933-110021955 CTGTCTGGGCACTGGAAATGTGG - Intergenic
1113412824 13:110105321-110105343 CAGTCTGTGCCCTGGGAACAGGG - Intergenic
1113882878 13:113637470-113637492 CAGGATGGGCTGTGGGAAGAGGG + Intronic
1114557775 14:23571622-23571644 TAGTCTGGGGAGTGGGACTTGGG - Intronic
1114575457 14:23708709-23708731 GAGTCAGGCTAGTGGGAATAAGG - Intergenic
1118107245 14:62673861-62673883 CAGTAGGGGCAGTGGGAGTCAGG - Intergenic
1119808050 14:77495588-77495610 CACTACGGGCAGTGGGGATAGGG + Intronic
1120368241 14:83598020-83598042 CAGACTGGGCAGGGTGAGTAGGG + Intergenic
1121488645 14:94341946-94341968 TATTTAGGGCAGTGGGAATATGG + Intergenic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1122307992 14:100777500-100777522 CACTCTGGGCGGCAGGAATAGGG - Intergenic
1122860531 14:104580454-104580476 CAGCCTGGGCAGTGGGAGAAGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124390396 15:29250507-29250529 CAGTCTGCGATGTGGGAAAACGG + Intronic
1124796061 15:32781113-32781135 AATTCTAGGTAGTGGGAATATGG + Intronic
1124876567 15:33600569-33600591 CTGCCTAGGAAGTGGGAATAAGG + Intronic
1127354019 15:58180961-58180983 AATTCTGGGCTCTGGGAATAAGG - Intronic
1129627580 15:77218838-77218860 CAGTCTGTGCAGTGTGAAATGGG - Intronic
1132010143 15:98268077-98268099 CACTCTCGGCAGTGGGCACAAGG - Intergenic
1132022035 15:98371120-98371142 CAGAATGGGCAGTGGGAATGAGG - Intergenic
1132854252 16:2037766-2037788 CCGTCTGGGGTGTGGGACTAGGG + Intronic
1133791659 16:9013689-9013711 CCATCTGGGCAGTAGGAATAAGG + Intergenic
1136554804 16:31001450-31001472 GAGGCTGGGCGGTGGGACTAGGG + Intronic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1141909748 16:87050551-87050573 CAGCCTGGGCAATGGGGACAGGG - Intergenic
1142183058 16:88681044-88681066 CGGTCTGGGCTGGGGGAAGAGGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142685409 17:1574710-1574732 CCGCCTGGTCAGTGGGGATAAGG + Exonic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143723099 17:8827360-8827382 CAGCCTAGGCTGTGTGAATATGG + Intronic
1143965838 17:10756042-10756064 CAGTCTGGGTAGGGAGAACAAGG - Intergenic
1146483514 17:33224815-33224837 ATGTCTGGCCAGTGGGTATAGGG - Intronic
1146745408 17:35324273-35324295 CACTTTGGGCAGTGGGTTTAAGG + Intergenic
1146759664 17:35466050-35466072 GAGTGCGGGCAGTGGGTATATGG - Intronic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1147115698 17:38297607-38297629 CAGACGGGGCAGTGACAATATGG - Intronic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1147904888 17:43816335-43816357 GAGTGTGAGCAGTGTGAATAGGG + Intronic
1147965527 17:44192491-44192513 CAGTCTGGGGAGTGGGCTGAAGG - Exonic
1149335071 17:55627153-55627175 GAGTCAGGGCAGTGGGACTAGGG + Intergenic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1149832736 17:59886137-59886159 CAGTCTGGCCAATGGAAATATGG - Exonic
1150201606 17:63362726-63362748 CAGAGTGGGCACTGGGAACAGGG + Intronic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1153303945 18:3615568-3615590 AAGTCTGGCCAGTAGGAAAATGG + Intronic
1155198909 18:23500793-23500815 CAGTCTGAGGAGTGTGAAGAAGG + Intergenic
1155247163 18:23921759-23921781 GAGACTGGGCAGTGGAAAGAAGG + Intronic
1155716404 18:28949714-28949736 TAGTCTAGGTAGTGGGAAGAAGG - Intergenic
1156498771 18:37543667-37543689 ATCTCTGGGGAGTGGGAATATGG + Intronic
1156829934 18:41479673-41479695 AATACTGGGGAGTGGGAATAGGG + Intergenic
1157238904 18:45990985-45991007 CAGTCCGGGTTGTGGGGATAAGG - Intronic
1157546567 18:48550623-48550645 CAGACTGTGCTGTGGGAAGAGGG - Intronic
1160191878 18:76721506-76721528 CAGTAGGGGCAGGGGGAAGATGG + Intergenic
1163580719 19:18137158-18137180 CAGCATGGGCAGTGGGGGTAGGG + Intronic
1164574680 19:29398829-29398851 CTGTCTGGGCAGTGGGATTGGGG - Intergenic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1164796724 19:31039662-31039684 TAGTCTGGGTTGTGGGAAGAGGG + Intergenic
1164996028 19:32720660-32720682 GAGTGGGGGCGGTGGGAATAAGG - Intronic
1165258106 19:34592188-34592210 CATTTTGGGCAGTGGGAGTGAGG + Intergenic
1166998489 19:46731216-46731238 CTGACTGGGCTGTGGGAATGGGG - Intronic
1167899460 19:52607995-52608017 GAGTCTGGCTAGTGGGAACAGGG + Intronic
1167959488 19:53094924-53094946 CAGCCTGGGCTGTGGGAAGCGGG - Intronic
1167959553 19:53095111-53095133 CGGTCTGGGCAATGGGAAAGGGG - Intronic
1168566374 19:57427643-57427665 CAGTCAGGGGACTGGGAATGAGG - Intronic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
927192447 2:20525878-20525900 CTGTCTGGGCTGTGGGCTTAAGG - Intergenic
927526793 2:23750729-23750751 CAGTCTAGGCAGTTGCAATGAGG - Exonic
928242495 2:29598528-29598550 CAGTCTTGCAAGTAGGAATAGGG + Intronic
929314830 2:40464666-40464688 CAGTCTGAGAAGTGGGGATGTGG + Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
929802411 2:45115443-45115465 CAGGCAGGGCAGAGGCAATAAGG + Intergenic
929869360 2:45745288-45745310 CTGTCAGGGCAGTGAGACTAAGG - Intronic
932060826 2:68495905-68495927 GAGCCAGAGCAGTGGGAATATGG + Intronic
932068494 2:68591831-68591853 GAGTCTGGGCACTGGGAATCTGG - Intronic
936907251 2:117551238-117551260 AAGTCAAGGCAGTGGCAATAGGG + Intergenic
937919769 2:127120888-127120910 CAGTCTGGGCAGTAGGCTTCAGG - Intergenic
938097431 2:128472881-128472903 CAGCCTTGGCAGTGGGATTCAGG - Intergenic
938421953 2:131153384-131153406 CTGCCTGGGAAGTGGGAATCAGG + Intronic
938838272 2:135130963-135130985 CTGTCTGGGCAGTGGGAATCAGG + Intronic
939984179 2:148814021-148814043 CAGGCTGGGCAGGAGGAAGAGGG - Intergenic
940247743 2:151637543-151637565 CAGTCTGGGTGGGTGGAATAGGG + Intronic
940357285 2:152757744-152757766 CAGTGTTCCCAGTGGGAATATGG + Intronic
940365460 2:152843780-152843802 CAGTTGGGGCAGTGGGTATATGG + Intergenic
942116329 2:172733163-172733185 AAGGCTGGGAGGTGGGAATAAGG - Intergenic
946345328 2:219105328-219105350 CTGTCTGGCCAGTGGAAATCTGG - Intronic
946784047 2:223223614-223223636 CATTCTGGGCACTGGGGACATGG + Intergenic
947531231 2:230909816-230909838 CTGTCTGGGCAGTGGAAAAAAGG + Exonic
947606761 2:231491130-231491152 AAGGCAGGGCAGTGGGAAGAGGG - Intergenic
948384078 2:237570929-237570951 CAGCCTGGACAGTGGGTACATGG + Intergenic
948399742 2:237674966-237674988 GAGCCTGGGCAGTGGGAGGAGGG + Intronic
1169415428 20:5412082-5412104 CTGTCTGGGAAGTGGGAGTGGGG - Intergenic
1169776599 20:9262071-9262093 CATTCTGGAAAGTGGGAATTTGG + Intronic
1170376589 20:15707401-15707423 CTTGCTGGGCACTGGGAATATGG + Intronic
1170700880 20:18702384-18702406 CAGTCTGGGAAATGAGAAAAGGG - Intronic
1170979941 20:21202708-21202730 CAATCTGGGCGGTGTGTATATGG - Intronic
1171431833 20:25087778-25087800 CAGTCTGGGGAGGGGGTGTATGG + Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172151635 20:32795071-32795093 CATGCTGGGCAGTAGGCATAGGG - Intronic
1172384144 20:34521694-34521716 CACTCTGGGCAATGGGATGATGG - Intronic
1173870930 20:46341707-46341729 CAGGCTGGGAAGTGGGGATGGGG + Intergenic
1174311472 20:49658727-49658749 CAGTCTGGGTAGTGGGACCTAGG - Intronic
1174547201 20:51334478-51334500 CATTCTAGGCACTGGGGATATGG - Intergenic
1175938693 20:62527203-62527225 CATGCTGGGCAGGGGGCATAAGG - Intergenic
1178639697 21:34336012-34336034 CAGCCTGGCCAGTGAGCATAAGG - Intergenic
1181108459 22:20588124-20588146 CACTCTGGTCAGTGGGAGAAGGG - Intergenic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182763556 22:32742326-32742348 CATTCTGGGCTGTGTGACTAAGG - Intronic
1183142621 22:35957457-35957479 CAGTCTGTGCTATGTGAATATGG - Intronic
1183980076 22:41534185-41534207 CAGTCTGGGCACTGGGCTCACGG + Intronic
1184101864 22:42345014-42345036 AAGCCTTGGCAGTGGGATTAAGG - Intergenic
949818922 3:8093960-8093982 TAGTCAGGGCAGTGCAAATAAGG - Intergenic
949837639 3:8286530-8286552 CAATCTGTGGAGTGGGCATAGGG + Intergenic
950525240 3:13519287-13519309 GAGTCTGGGGAGTGGGACAATGG + Intergenic
951669483 3:25164123-25164145 CAGTCTGGCCACTGGGGAGAAGG + Intergenic
953057641 3:39400911-39400933 CAGTCTGGGAAATGTGAATATGG - Intergenic
953373543 3:42409705-42409727 CTGTGTGGGCAGTGGGTTTAGGG - Intronic
955031937 3:55230538-55230560 CAGTCTAGGAAGTGGGAGAAGGG - Intergenic
955056423 3:55459657-55459679 CAGTCTGGGCAGGGGTAGCAGGG - Intergenic
955410051 3:58649411-58649433 GGGGCTGGGGAGTGGGAATAAGG + Intronic
955907843 3:63826358-63826380 TAGTCAGGGCAGTGGGAATGGGG + Intronic
962637501 3:137346144-137346166 CATTATGGGCAGTGGGACAAAGG - Intergenic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
965229318 3:166029737-166029759 CAGACTGGGCACTGGGTATGGGG + Intergenic
966740385 3:183227349-183227371 AAGTCTGGGAGGTGGGAAGAAGG + Intronic
966805795 3:183806469-183806491 CTCTCTGAGCAGTGAGAATAGGG + Intronic
967980161 3:195060826-195060848 CAGTCTGGGCAGTGTCACCATGG + Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968952527 4:3702368-3702390 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968952546 4:3702416-3702438 CAGTCCGGGCAGTGGGAGGAGGG - Intergenic
968952554 4:3702440-3702462 CAGTCCGGGCAGTGGGAGGGGGG - Intergenic
969568899 4:7996396-7996418 CAGCCTGGGCACTGGGAACCTGG - Intronic
969781200 4:9405772-9405794 CAGTGTCCACAGTGGGAATATGG - Intergenic
971537780 4:27775610-27775632 CAATCTGGGAATTGGGAATTAGG + Intergenic
973850406 4:54956171-54956193 AAGTCAGAGCAGTGGGAATCTGG - Intergenic
973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG + Intronic
974581929 4:63814651-63814673 CAGTATGGGGAGTGAGAATGTGG + Intergenic
977303774 4:95298366-95298388 CAGTGTGTGCAGTTGGCATAGGG - Intronic
977578142 4:98696458-98696480 CAGGCTGGGGAGTGGGAAGAGGG + Intergenic
978317222 4:107451811-107451833 CACCCTGCCCAGTGGGAATATGG - Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
979063393 4:116097083-116097105 CAACCTGGGCAGTGTGAAGATGG - Intergenic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
980748892 4:137061926-137061948 GTGTTTGGGCAGTGGGTATATGG + Intergenic
981134398 4:141193519-141193541 TATTCTGGGCACTGGGGATATGG + Intronic
981727247 4:147861292-147861314 CATTGTGGGCACTGGGAACACGG + Intronic
981783029 4:148446219-148446241 CTGTCAGGACAGTGGGAATGTGG - Intergenic
983247215 4:165301658-165301680 CAGTCTTGGCAGTGAGTTTAAGG + Intronic
984073088 4:175140706-175140728 CAGTCTGAGCTGTTGGAATCAGG - Intergenic
985166002 4:187094894-187094916 CAGTCTCGGAAGTGGGTAAACGG - Intergenic
985827468 5:2203666-2203688 AAGTCTGGGAGGTGGGGATAGGG - Intergenic
985861312 5:2472867-2472889 AACTCTGGGCAGTGGGAGTGCGG - Intergenic
986989674 5:13537060-13537082 CAGTCCAGGCACTGGGAATTAGG - Intergenic
987976625 5:25022946-25022968 GAGTCTGGGAAATGGGAAAAAGG - Intergenic
988087235 5:26487707-26487729 TGGTCTGGTCAGTGGGAACAAGG - Intergenic
988389072 5:30603552-30603574 CAATCTGGGTAGTGGGCATGAGG + Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
991255926 5:64614750-64614772 AAATATGGGCAGTGGGGATATGG + Intergenic
992271828 5:75072377-75072399 CATTCTAGGCATTAGGAATAAGG - Intronic
993671345 5:90764784-90764806 CAGGCAGGGCAGTGGCACTATGG + Intronic
993713043 5:91247097-91247119 CACTCCAGGCAGTGGGGATATGG - Intergenic
995530732 5:113089519-113089541 CAGTCAGCGAAGTGGGAATAAGG + Intronic
995723925 5:115165853-115165875 CAGAGTGGGCACTGGGAATGGGG - Intronic
997382331 5:133446677-133446699 GGGGCTGGGCTGTGGGAATACGG - Intronic
997626375 5:135333937-135333959 CAGCCTCGGCAGAGGGAATGAGG + Exonic
997992527 5:138557337-138557359 CAGTCTTGACAGTGGGAGTTTGG - Intronic
998108796 5:139485484-139485506 TACTCTGTGCAGTTGGAATATGG + Intergenic
1001711179 5:173779499-173779521 CATTCTGGGTACTGGGAATATGG - Intergenic
1002315838 5:178342446-178342468 CAGTCTGGGCAGTGGCTCAAAGG + Intronic
1002679771 5:180952066-180952088 CTGTGTGGGCAGAGGGTATATGG - Intergenic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005812737 6:29529410-29529432 CAGGCTGGGCAGTGGCAGTTGGG - Intergenic
1006488307 6:34363546-34363568 GAGTCTTGGCAGTGGGAAACAGG + Intronic
1008553171 6:52652697-52652719 CAGTCTGGGGAGTGGAGATCAGG + Intergenic
1009929466 6:70160036-70160058 CCTCCTGGGTAGTGGGAATAGGG - Intronic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013585717 6:111576800-111576822 AAATCTGGGTAGTGGGAACATGG + Intronic
1014018841 6:116565393-116565415 CAGTGTGGGCAGCGGGGATGGGG + Intergenic
1014828870 6:126077984-126078006 CAGACTGGGGTTTGGGAATATGG + Intergenic
1018491551 6:164299003-164299025 CAGCCAAGGCACTGGGAATAGGG - Intergenic
1019873393 7:3788398-3788420 GAGTCTGTGCAGAGGGGATAAGG + Intronic
1019927719 7:4204410-4204432 CAGGGTGGGCAGTGATAATACGG + Intronic
1021420903 7:20443661-20443683 CAATCTGGGCAGTGGGGTGAGGG - Intergenic
1022280413 7:28903057-28903079 CACACTGAGCAGTGGGAACAGGG - Intergenic
1023741743 7:43287326-43287348 CATTCCTGGCAGTGGGAGTAGGG + Intronic
1028473866 7:91232850-91232872 CAGGCTGGCCAGTGGGAATTTGG + Intergenic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1031687821 7:124753737-124753759 CAGTCTTGCCAGTGGTGATAAGG - Intronic
1032141406 7:129334249-129334271 TAATCTGGGCTGTGGGAAGATGG + Intronic
1036278633 8:7379689-7379711 CAGTGTCCACAGTGGGAATATGG - Intronic
1036342889 8:7932179-7932201 CAGTGTCCACAGTGGGAATATGG + Intronic
1036838231 8:12092934-12092956 CAGTGTCCACAGTGGGAATATGG + Intergenic
1036860021 8:12339182-12339204 CAGTGTCCACAGTGGGAATATGG + Intergenic
1038401421 8:27287477-27287499 CAGTGTGGGCATTAGGAAGAGGG + Exonic
1038429291 8:27486699-27486721 CAGGCTGGGGAGTGGGCACAGGG + Intergenic
1039183247 8:34889810-34889832 GAGTTAGGGCAGTGGGAATTGGG + Intergenic
1039576985 8:38631583-38631605 AACTCTGGGCAGTGGGGGTAAGG - Intergenic
1039808942 8:41027646-41027668 CAGTGGGGGCAGAGGGAATCTGG - Intergenic
1042992605 8:74657267-74657289 CAGTCTGGGGAGTGAGGATGGGG + Intronic
1046359629 8:113132769-113132791 GAGACTGTGCATTGGGAATAGGG + Intronic
1047355970 8:124122214-124122236 TGTTCTGGGCAGTGGGGATACGG + Intergenic
1048996754 8:139799396-139799418 CAGTGTGGTCAGTGGAAAAATGG - Intronic
1049618873 8:143588941-143588963 CAGCCTGGGCTGTGGGCACAGGG - Intronic
1050555750 9:6788450-6788472 AAATCTGGGCAGTGAGAACAGGG - Intronic
1052993689 9:34537905-34537927 CAGTCTGGGACTTGGGAGTAAGG - Intergenic
1058149096 9:101444269-101444291 CAGTTAGGGCAGAGGGAATGGGG + Intergenic
1058810491 9:108634262-108634284 CAATCCGGGCAGTGAGAAGAAGG - Intergenic
1059432422 9:114258265-114258287 GAGTCTGGGGAGTGGGGATAAGG - Intronic
1061432047 9:130537243-130537265 CAGGCTGGGCTGTTGGAACAGGG - Intergenic
1061457389 9:130708837-130708859 GAGTCTGGGCATTGGGCATGGGG + Intergenic
1186442403 X:9597555-9597577 CAGTCTGGCCAGTGGGCAGCTGG - Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1188043294 X:25395783-25395805 TATTCTGGGCAGTGTGAATCAGG + Intergenic
1190399157 X:50014338-50014360 CTGCCAGGGCAGTGGGCATATGG + Intronic
1192217942 X:69177074-69177096 AAGTCAGGACAGTGGGAAAAGGG - Intergenic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1194998894 X:100622773-100622795 CTCTCTGGGCAGTGGGAGTGAGG + Intergenic
1195241908 X:102960509-102960531 CAGTCTTGGCAGGGTGATTAAGG - Intergenic
1195670021 X:107461859-107461881 GAGTCTGGGCATTGGGAAGTGGG - Intergenic
1196395539 X:115257944-115257966 GAATTTGTGCAGTGGGAATAAGG - Intergenic
1197318000 X:124992213-124992235 CAGTCTTGGCAGTGGGGAGCAGG - Intergenic
1197760251 X:130022971-130022993 CAGTCTGGTGAGTGAGACTAAGG + Exonic
1198736497 X:139791428-139791450 CAGTTTGGGCAGTATGAATCTGG + Intronic
1202129671 Y:21598274-21598296 CAGTCTGAGGTGTGAGAATACGG - Intergenic