ID: 1010812395

View in Genome Browser
Species Human (GRCh38)
Location 6:80315126-80315148
Sequence AGATTTAGCCGCCTTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010812390_1010812395 6 Left 1010812390 6:80315097-80315119 CCTGTAGAACTGACACTGCTCAG 0: 1
1: 0
2: 0
3: 11
4: 92
Right 1010812395 6:80315126-80315148 AGATTTAGCCGCCTTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010812395 Original CRISPR AGATTTAGCCGCCTTCCTAG GGG Intronic
No off target data available for this crispr