ID: 1010813821

View in Genome Browser
Species Human (GRCh38)
Location 6:80331162-80331184
Sequence CAGTCATGGCCTTAAGCATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010813815_1010813821 9 Left 1010813815 6:80331130-80331152 CCATAGTGATCTAACAGCCTCTG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG No data
1010813819_1010813821 -8 Left 1010813819 6:80331147-80331169 CCTCTGGAGGGAATGCAGTCATG 0: 1
1: 0
2: 3
3: 47
4: 353
Right 1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010813821 Original CRISPR CAGTCATGGCCTTAAGCATC CGG Intronic
No off target data available for this crispr