ID: 1010816750

View in Genome Browser
Species Human (GRCh38)
Location 6:80366872-80366894
Sequence AACAGACATCTGGCAGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010816748_1010816750 1 Left 1010816748 6:80366848-80366870 CCTTCATGCTTAGTGTCTATTCT No data
Right 1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG No data
1010816747_1010816750 9 Left 1010816747 6:80366840-80366862 CCACTTAACCTTCATGCTTAGTG No data
Right 1010816750 6:80366872-80366894 AACAGACATCTGGCAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010816750 Original CRISPR AACAGACATCTGGCAGAATT AGG Intergenic
No off target data available for this crispr