ID: 1010818629

View in Genome Browser
Species Human (GRCh38)
Location 6:80388372-80388394
Sequence AGTTATCTGCAGATAATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010818629_1010818631 4 Left 1010818629 6:80388372-80388394 CCTGCCATTATCTGCAGATAACT No data
Right 1010818631 6:80388399-80388421 TCCTTTTGAGAGACAGCTCCTGG No data
1010818629_1010818634 22 Left 1010818629 6:80388372-80388394 CCTGCCATTATCTGCAGATAACT No data
Right 1010818634 6:80388417-80388439 CCTGGCCTGTTACTGAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010818629 Original CRISPR AGTTATCTGCAGATAATGGC AGG (reversed) Intergenic
No off target data available for this crispr