ID: 1010823727

View in Genome Browser
Species Human (GRCh38)
Location 6:80447614-80447636
Sequence ATGGATTCCTTGGGACAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010823727_1010823733 -1 Left 1010823727 6:80447614-80447636 CCCTTTTGTCCCAAGGAATCCAT No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010823727 Original CRISPR ATGGATTCCTTGGGACAAAA GGG (reversed) Intergenic
No off target data available for this crispr