ID: 1010823733

View in Genome Browser
Species Human (GRCh38)
Location 6:80447636-80447658
Sequence TGGATTACTTTCTGTCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010823730_1010823733 -10 Left 1010823730 6:80447623-80447645 CCCAAGGAATCCATGGATTACTT No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data
1010823727_1010823733 -1 Left 1010823727 6:80447614-80447636 CCCTTTTGTCCCAAGGAATCCAT No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data
1010823723_1010823733 17 Left 1010823723 6:80447596-80447618 CCTAGCTCTCCTGCCTAACCCTT No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data
1010823724_1010823733 8 Left 1010823724 6:80447605-80447627 CCTGCCTAACCCTTTTGTCCCAA No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data
1010823726_1010823733 4 Left 1010823726 6:80447609-80447631 CCTAACCCTTTTGTCCCAAGGAA No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data
1010823728_1010823733 -2 Left 1010823728 6:80447615-80447637 CCTTTTGTCCCAAGGAATCCATG No data
Right 1010823733 6:80447636-80447658 TGGATTACTTTCTGTCACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010823733 Original CRISPR TGGATTACTTTCTGTCACAT TGG Intergenic
No off target data available for this crispr